dopey2

Ensembl ID:
ENSDARG00000055857
ZFIN ID:
ZDB-GENE-040426-1195
Human Orthologue:
DOPEY2
Human Description:
dopey family member 2 [Source:HGNC Symbol;Acc:1291]
Mouse Orthologue:
Dopey2
Mouse Description:
dopey family member 2 Gene [Source:MGI Symbol;Acc:MGI:1917278]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16432 Essential Splice Site Available for shipment Available now
sa21523 Nonsense Available for shipment Available now
sa13946 Nonsense Available for shipment Available now
sa41462 Nonsense Mutation detected in F1 DNA During 2017
sa38748 Nonsense Mutation detected in F1 DNA During 2017
sa7195 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17692 Nonsense Available for shipment Available now
sa9132 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078256 Essential Splice Site 302 2260 7 41
ENSDART00000131910   None 1485 None 23
ENSDART00000132465 Essential Splice Site 302 542 8 13

The following transcripts of ENSDARG00000055857 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34198219)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33354165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCAATATTAAGGAATTCATYTTTATTTTATTTGTGTGTGACTTGTCA[G/T]GCTTGGACATTAAAGGAGGAAYGGGGGCTGCAGACTCCAGTCACTACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078256 Nonsense 663 2260 14 41
ENSDART00000131910   None 1485 None 23
ENSDART00000132465   None 542 None 13

The following transcripts of ENSDARG00000055857 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34206437)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33362383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTAGATATAGTGGATCCAGAGAAGAAGAAGAAACAGGAAGAAGCAAAT[C/T]AGCTTGATGCTAATGCGTCTCCTAAAAGCAGCAAGCGGTCTCCACTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13946
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078256 Nonsense 798 2260 15 41
ENSDART00000131910   None 1485 None 23
ENSDART00000132465   None 542 None 13

The following transcripts of ENSDARG00000055857 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34206927)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33362873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGGAACTCTTCCTGACTGGCTGAGGTCTTTGATGACTCWGTGTTGCT[T/G]RACTAAAGACTACCAGGTACCAGTTCACAAGCACTCAAAATGTAAAYATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078256 Nonsense 1196 2260 20 41
ENSDART00000131910 Nonsense 393 1485 5 23
ENSDART00000132465   None 542 None 13

The following transcripts of ENSDARG00000055857 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34211487)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33367433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACGTGAGGCGGTGGATTCACTCTTCCGCCATGTTCTGCTCTATAAG[C/T]AGAAGTACGAGAGCAGCCAGATTCTGTACGCCTTCACTATTTTAGAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078256 Nonsense 1294 2260 21 41
ENSDART00000131910 Nonsense 508 1485 5 23
ENSDART00000132465   None 542 None 13

The following transcripts of ENSDARG00000055857 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34211834)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33367780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTTACCAGCCTTTGCATGCGCTACCTCCGCTCTCACTATCCCTCATA[T/A]GCTAGTGTTCCCACTCGCCAACTCCAAGCCAATCGAGAGGTGCAGGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078256 Essential Splice Site 1538 2260 None 41
ENSDART00000131910 Essential Splice Site 766 1485 None 23
ENSDART00000132465   None 542 None 13

The following transcripts of ENSDARG00000055857 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34212609)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33368555
KASP Assay ID:
554-5081.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGCTTGTTAAACAGCACGAGCACGATGGAATCAAGGGTTCACACAAG[T/C]AAATATTCWGTGTGGTTGTTTGTGTGAGAGTGGAAGCACATGATTTGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078256 Nonsense 2018 2260 36 41
ENSDART00000131910 Nonsense 1243 1485 18 23
ENSDART00000132465   None 542 None 13

The following transcripts of ENSDARG00000055857 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34220640)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33376586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACAGGCTTTTGCCATGTTTAGYGGAGAAAATGACCAGTACCACTTCTA[T/A]TTGCCTCTMATTCAAGGTATCACTCAGTTTGTRTGGAAAACAAATACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078256 Nonsense 2034 2260 37 41
ENSDART00000131910 Nonsense 1259 1485 19 23
ENSDART00000132465   None 542 None 13

The following transcripts of ENSDARG00000055857 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 34220774)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33376720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTAACNNATATATTGTAGARCGTCTGACAGAGAACCTGCGTGTAGGA[C/T]AGAGCCCATCAGTGTCAGCTCAGATGTTTCTCATGTTTCGTGTTCTCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link