kcnc3a

Ensembl ID:
ENSDARG00000055855
ZFIN ID:
ZDB-GENE-100901-1
Description:
potassium voltage-gated channel subfamily C member 3 [Source:RefSeq peptide;Acc:NP_001182169]
Human Orthologue:
KCNC3
Human Description:
potassium voltage-gated channel, Shaw-related subfamily, member 3 [Source:HGNC Symbol;Acc:6235]
Mouse Orthologue:
Kcnc3
Mouse Description:
potassium voltage gated channel, Shaw-related subfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:96

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14531 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078249 Nonsense 227 666 2 7
Genomic Location:
Chromosome 3 (position 32158528)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGTTCGGCTCGCTCCTGTTCATCCTCATCTCCATCTCAACATTTTGCT[T/A]GGAGACACACGAGGCCTTCAACACCATCTACAATAAGACAGAGAACGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pq4kpgf9