nr4a3

Ensembl ID:
ENSDARG00000055854
ZFIN ID:
ZDB-GENE-070824-4
Description:
nuclear receptor subfamily 4, group A, member 3 [Source:RefSeq peptide;Acc:NP_001166100]
Human Orthologue:
NR4A3
Human Description:
nuclear receptor subfamily 4, group A, member 3 [Source:HGNC Symbol;Acc:7982]
Mouse Orthologue:
Nr4a3
Mouse Description:
nuclear receptor subfamily 4, group A, member 3 Gene [Source:MGI Symbol;Acc:MGI:1352457]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2842 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078250 Nonsense 202 594 1 6
ENSDART00000142573   None 186 None 5
Genomic Location (Zv9):
Chromosome 16 (position 29574226)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27411364
KASP Assay ID:
554-2595.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTCTTCRTCTTCACATGTGCCACCCAACATGGACACACATGCACACT[C/A]ACACGTGCACTCCCATACGCACTCAAACATGTAYCCGMTCAACATGGGTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link