cdh10

Ensembl ID:
ENSDARG00000055843
ZFIN ID:
ZDB-GENE-060614-1
Description:
cadherin-10 [Source:RefSeq peptide;Acc:NP_001034722]
Human Orthologues:
CDH10, CDH6, CDH9
Human Descriptions:
cadherin 10, type 2 (T2-cadherin) [Source:HGNC Symbol;Acc:1749]
cadherin 6, type 2, K-cadherin (fetal kidney) [Source:HGNC Symbol;Acc:1765]
cadherin 9, type 2 (T1-cadherin) [Source:HGNC Symbol;Acc:1768]
Mouse Orthologues:
Cdh10, Cdh6, Cdh9
Mouse Descriptions:
cadherin 10 Gene [Source:MGI Symbol;Acc:MGI:107436]
cadherin 6 Gene [Source:MGI Symbol;Acc:MGI:107435]
cadherin 9 Gene [Source:MGI Symbol;Acc:MGI:107433]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15260 Nonsense Available for shipment Available now
sa25822 Essential Splice Site Mutation detected in F1 DNA During 2015
sa1332 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078232 Nonsense 8 785 2 12
Genomic Location:
Chromosome 2 (position 28617713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCATCGTGACRATCRWTTGGCTGCARTGATAATGAATCACTTCCTCTG[G/A]CTGCTTCCACTGGTCTTTCCGCACCTGAGCTCCCCAGTCATACTGCTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078232 Essential Splice Site 332 785 7 12
Genomic Location:
Chromosome 2 (position 28639148)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTAATTACACTGTGCAGATATATGCAATGACTCATGGTCTCCATCC[A/T]GAAATTGGACTACGAAACCAAACGCGTTTACACTGTGAAAGTGGAGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078232 Nonsense 633 785 12 12
Genomic Location:
Chromosome 2 (position 28648655)
KASP Assay ID:
554-1246.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATCTTCACTTTCCTCCAGTGATTGTGGTGCTGTTCTCGGCTCTGAAG[A/T]AACAGAGGAGAAAGGARCCCCTKATCATCTCGAAGGAGGACGTCCGGGAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9i0nnmyn