cdh10

Ensembl ID:
ENSDARG00000055843
ZFIN ID:
ZDB-GENE-060614-1
Description:
cadherin-10 [Source:RefSeq peptide;Acc:NP_001034722]
Human Orthologues:
CDH10, CDH6, CDH9
Human Descriptions:
cadherin 10, type 2 (T2-cadherin) [Source:HGNC Symbol;Acc:1749]
cadherin 6, type 2, K-cadherin (fetal kidney) [Source:HGNC Symbol;Acc:1765]
cadherin 9, type 2 (T1-cadherin) [Source:HGNC Symbol;Acc:1768]
Mouse Orthologues:
Cdh10, Cdh6, Cdh9
Mouse Descriptions:
cadherin 10 Gene [Source:MGI Symbol;Acc:MGI:107436]
cadherin 6 Gene [Source:MGI Symbol;Acc:MGI:107435]
cadherin 9 Gene [Source:MGI Symbol;Acc:MGI:107433]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15260 Nonsense Available for shipment Available now
sa1332 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078232 Nonsense 8 785 2 12
Genomic Location:
Chromosome 2 (position 28617713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCATCGTGACRATCRWTTGGCTGCARTGATAATGAATCACTTCCTCTG[G/A]CTGCTTCCACTGGTCTTTCCGCACCTGAGCTCCCCAGTCATACTGCTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078232 Nonsense 633 785 12 12
Genomic Location:
Chromosome 2 (position 28648655)
KASP Assay ID:
554-1246.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATCTTCACTTTCCTCCAGTGATTGTGGTGCTGTTCTCGGCTCTGAAG[A/T]AACAGAGGAGAAAGGARCCCCTKATCATCTCGAAGGAGGACGTCCGGGAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9i0nnmyn