mett10d

Ensembl ID:
ENSDARG00000055838
ZFIN ID:
ZDB-GENE-040801-130
Description:
Putative methyltransferase METT10D [Source:UniProtKB/Swiss-Prot;Acc:Q6DC64]
Human Orthologue:
METT10D
Human Description:
methyltransferase 10 domain containing [Source:HGNC Symbol;Acc:28484]
Mouse Orthologue:
Mett10d
Mouse Description:
methyltransferase 10 domain containing Gene [Source:MGI Symbol;Acc:MGI:1914743]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1221 Essential Splice Site Available for shipment Available now
sa4609 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078230 Essential Splice Site 106 471 3 10

The following transcripts of ENSDARG00000055838 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 24574457)
KASP Assay ID:
554-1130.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGACCTGATCGGGGGGCAGGGAAACCCGCAGAGGGGCATTGACATTGG[T/C]ATGCCAGCTCAGACTCATGGCTGTTATCCCGTTAAAGCTGTTTGTRGTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa4609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078230 Nonsense 169 471 5 10

The following transcripts of ENSDARG00000055838 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 24570001)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGGTGAAAGTCCCCCAGAAGACTCTCCTGATGGATGCGCTGAAGGAA[G/T]AGTCCATTGTCTATGATTTCTGCATGTGCAATCCTCCATTCTTCGCCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oj1nnp0u