si:dkey-216e24.3

Ensembl ID:
ENSDARG00000055833
ZFIN ID:
ZDB-GENE-070912-438
Description:
Novel protein containing lectin C-type domains [Source:UniProtKB/TrEMBL;Acc:B0S6P2]
Human Orthologues:
REG1A, REG1B, REG3A, REG3G, REG4
Human Descriptions:
regenerating islet-derived 1 alpha [Source:HGNC Symbol;Acc:9951]
regenerating islet-derived 1 beta [Source:HGNC Symbol;Acc:9952]
regenerating islet-derived 3 alpha [Source:HGNC Symbol;Acc:8601]
regenerating islet-derived 3 gamma [Source:HGNC Symbol;Acc:29595]
regenerating islet-derived family, member 4 [Source:HGNC Symbol;Acc:22977]
Mouse Orthologues:
Reg1, Reg2, Reg3a, Reg3b, Reg3d, Reg3g, Reg4
Mouse Descriptions:
regenerating islet-derived 1 Gene [Source:MGI Symbol;Acc:MGI:97895]
regenerating islet-derived 2 Gene [Source:MGI Symbol;Acc:MGI:97896]
regenerating islet-derived 3 alpha Gene [Source:MGI Symbol;Acc:MGI:109408]
regenerating islet-derived 3 beta Gene [Source:MGI Symbol;Acc:MGI:97478]
regenerating islet-derived 3 delta Gene [Source:MGI Symbol;Acc:MGI:1353426]
regenerating islet-derived 3 gamma Gene [Source:MGI Symbol;Acc:MGI:109406]
regenerating islet-derived family, member 4 Gene [Source:MGI Symbol;Acc:MGI:1914959]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7196 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110066 Essential Splice Site 91 152 5 6
ENSDART00000138871 Essential Splice Site 91 152 6 7
Genomic Location (Zv9):
Chromosome 9 (position 34271109)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33427055
KASP Assay ID:
554-4308.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTCCAATGTTGTCTACATACAAGAGCTCTAAACCTCTCCACTCATTA[G/T]GAAGAAAACTGGTTTTGGTCTGAWGGATCTTCATTTGGTTATRCCAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link