celsr3

Ensembl ID:
ENSDARG00000055825
ZFIN ID:
ZDB-GENE-070122-3
Description:
Cadherin, EGF LAG seven-pass G-type receptor 3 [Source:UniProtKB/TrEMBL;Acc:A9C3S7]
Human Orthologue:
CELSR3
Human Description:
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Mouse Orthologue:
Celsr3
Mouse Description:
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2445 Nonsense F2 line generated During 2014
sa9305 Nonsense Mutation detected in F1 DNA During 2014
sa11108 Essential Splice Site Available for shipment Available now
sa3674 Nonsense Mutation detected in F1 DNA During 2014
sa7333 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2014
sa10576 Essential Splice Site Available for shipment Available now
sa21306 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2445
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 718 2916 1 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Nonsense 748 2065 1 21
Genomic Location:
Chromosome 8 (position 26980404)
KASP Assay ID:
554-3086.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATAGTCCGAACTGTCCGGAGACTTGACCGTGAAAGCGTTCCCTTCTA[C/A]GAGCTGACAGCATTTGCTGTGGATCGTGGCGTTCCACCTCAGCGTACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 1485 2916 10 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Nonsense 1515 2065 10 21
Genomic Location:
Chromosome 8 (position 27027231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCGCACCCGATCCAAAGAGGGGGTCCTGCTGCAGGCTCAAGCTGGA[C/T]AGTACACCAACCTGATCTTCCAGGTAAATATGCTTACAAAANNNNNNNNNNACAAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Essential Splice Site 1695 2916 14 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Essential Splice Site 1725 2065 14 21
Genomic Location:
Chromosome 8 (position 27032694)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAWCTGTGACTGTGAGGATAGTCAYTATGGACAATAYTGCCAACACAGG[T/C]ACACATTCACAAACACTGCATGCGTTCACACTATTACGCCCCAAGTCTNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 1780 2916 16 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Nonsense 1810 2065 16 21
Genomic Location:
Chromosome 8 (position 27038311)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAGAGCGGGCAGTGCCAGTGTCGACCYGGCGTSATTGGCCGCCAGTG[C/A]AACATGTGCGACAATCCGTTTGCTGAGGTCACACAGACCGGCTGTGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Essential Splice Site 1831 2916 18 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 Splice Site None 2065 None 21
Genomic Location:
Chromosome 8 (position 27038618)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTAATAAATCTTTTTTCTTTTTANATTCCTCTAATGCCNNNTTTTTTTTTT[G/T]AAGGAACTGCTATTCGCCACTGTGAWGGAGAGAGAGGATGGCTGGACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Essential Splice Site 2045 2916 21 40
ENSDART00000131888 None None 441 None 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 None None 2065 None 21
Genomic Location:
Chromosome 8 (position 27043509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCATGTTGTGCTGCCCCCTGCTGCACTAGTGCCACAACGCAATGTCTG[T/A]AAGTCACACAYKCACAAGTTATTAAAGTWCTYCAACAAAGCATAGTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 2828 2916 40 40
ENSDART00000131888 Nonsense 322 441 4 4
ENSDART00000137391 None None 407 None 9
ENSDART00000145095 None None 2065 None 21
Genomic Location:
Chromosome 8 (position 27063620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGATGAGCAGTCGGTCCCGCGAGCAGCTGGAGTCTAATGGTGGAGCA[C/T]AGCCCTGCAGAGAGTGGCTGAGGACCCTGCCGCCCCGCCAGCTCTCACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8ldng0ll