celsr3

Ensembl ID:
ENSDARG00000055825
ZFIN ID:
ZDB-GENE-070122-3
Description:
Cadherin, EGF LAG seven-pass G-type receptor 3 [Source:UniProtKB/TrEMBL;Acc:A9C3S7]
Human Orthologue:
CELSR3
Human Description:
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) [Source:HGNC Symbol;Ac
Mouse Orthologue:
Celsr3
Mouse Description:
cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) Gene [Source:MGI Symbo

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34415 Nonsense Mutation detected in F1 DNA During 2016
sa38693 Nonsense Mutation detected in F1 DNA During 2016
sa2445 Nonsense F2 line generated During 2016
sa34416 Nonsense Mutation detected in F1 DNA During 2016
sa9305 Nonsense Mutation detected in F1 DNA During 2016
sa11108 Essential Splice Site Available for shipment Available now
sa3674 Nonsense Mutation detected in F1 DNA During 2016
sa7333 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2016
sa34417 Nonsense Mutation detected in F1 DNA During 2016
sa10576 Essential Splice Site Available for shipment Available now
sa38694 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21306 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 127 2916 1 40
ENSDART00000131888   None 441 None 4
ENSDART00000137391   None 407 None 9
ENSDART00000145095 Nonsense 157 2065 1 21
Genomic Location:
Chromosome 8 (position 26978629)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGACCGAAATGATCACTCACCTGTGTTTGAGCAAACAGAGTATCGT[G/T]AGACCATTCGGGAGAATGTAGAAGAGGGATATCCGATACTACAGCTGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 183 2916 1 40
ENSDART00000131888   None 441 None 4
ENSDART00000137391   None 407 None 9
ENSDART00000145095 Nonsense 213 2065 1 21
Genomic Location:
Chromosome 8 (position 26978797)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCACGCTCTGCTTTTGAAATTGATCCACGGTCAGGCTTGATCACAACA[C/T]GAGGTATTGTTGATAGAGAAACAAACGAGCGCTATACATTGTTGGTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2445
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 718 2916 1 40
ENSDART00000131888   None 441 None 4
ENSDART00000137391   None 407 None 9
ENSDART00000145095 Nonsense 748 2065 1 21
Genomic Location:
Chromosome 8 (position 26980404)
KASP Assay ID:
554-3086.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATAGTCCGAACTGTCCGGAGACTTGACCGTGAAAGCGTTCCCTTCTA[C/A]GAGCTGACAGCATTTGCTGTGGATCGTGGCGTTCCACCTCAGCGTACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 1365 2916 8 40
ENSDART00000131888   None 441 None 4
ENSDART00000137391   None 407 None 9
ENSDART00000145095 Nonsense 1395 2065 8 21
Genomic Location:
Chromosome 8 (position 27025363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAGGAGGAGTTCCTAACCTGCCTGAGAACTTCCCTTTTAGTACACGA[G/T]AATTTATTGGCTGCATGAAAGACCTGCATATTGATAACAGACCAGTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 1485 2916 10 40
ENSDART00000131888   None 441 None 4
ENSDART00000137391   None 407 None 9
ENSDART00000145095 Nonsense 1515 2065 10 21
Genomic Location:
Chromosome 8 (position 27027231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCGCACCCGATCCAAAGAGGGGGTCCTGCTGCAGGCTCAAGCTGGA[C/T]AGTACACCAACCTGATCTTCCAGGTAAATATGCTTACAAAANNNNNNNNNNACAAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Essential Splice Site 1695 2916 14 40
ENSDART00000131888   None 441 None 4
ENSDART00000137391   None 407 None 9
ENSDART00000145095 Essential Splice Site 1725 2065 14 21
Genomic Location:
Chromosome 8 (position 27032694)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAWCTGTGACTGTGAGGATAGTCAYTATGGACAATAYTGCCAACACAGG[T/C]ACACATTCACAAACACTGCATGCGTTCACACTATTACGCCCCAAGTCTNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 1780 2916 16 40
ENSDART00000131888   None 441 None 4
ENSDART00000137391   None 407 None 9
ENSDART00000145095 Nonsense 1810 2065 16 21
Genomic Location:
Chromosome 8 (position 27038311)
KASP Assay ID:
2260-0665.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAGAGCGGGCAGTGCCAGTGTCGACCYGGCGTSATTGGCCGCCAGTG[C/A]AACATGTGCGACAATCCGTTTGCTGAGGTCACACAGACCGGCTGTGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Essential Splice Site 1831 2916 18 40
ENSDART00000131888   None 441 None 4
ENSDART00000137391   None 407 None 9
ENSDART00000145095 Splice Site None 2065 None 21
Genomic Location:
Chromosome 8 (position 27038618)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTAATAAATCTTTTTTCTTTTTANATTCCTCTAATGCCNNNTTTTTTTTTT[G/T]AAGGAACTGCTATTCGCCACTGTGAWGGAGAGAGAGGATGGCTGGACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 1844 2916 18 40
ENSDART00000131888   None 441 None 4
ENSDART00000137391   None 407 None 9
ENSDART00000145095 Nonsense 1871 2065 18 21
Genomic Location:
Chromosome 8 (position 27038659)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTTGAAGGAACTGCTATTCGCCACTGTGATGGAGAGAGAGGATG[G/A]CTGGACCCTGACCTGTACAACTGCACCTCTCCTCCTTTTGTGGAGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Essential Splice Site 2045 2916 21 40
ENSDART00000131888   None 441 None 4
ENSDART00000137391   None 407 None 9
ENSDART00000145095   None 2065 None 21
Genomic Location:
Chromosome 8 (position 27043509)
KASP Assay ID:
2260-0666.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCATGTTGTGCTGCCCCCTGCTGCACTAGTGCCACAACGCAATGTCTG[T/A]AAGTCACACAYKCACAAGTTATTAAAGTWCTYCAACAAAGCATAGTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Essential Splice Site 2326 2916 30 40
ENSDART00000131888   None 441 None 4
ENSDART00000137391 Essential Splice Site 227 407 5 9
ENSDART00000145095   None 2065 None 21
Genomic Location:
Chromosome 8 (position 27053151)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATATTTAGGCTTTCACACTTATGTGCTCAATAATATGTGTGTGTGTTGA[A/C]GGGCTAGCAGTCGGGTTGGATCCAGAGGGCTACGGTAACCCAGATTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078334 Nonsense 2828 2916 40 40
ENSDART00000131888 Nonsense 322 441 4 4
ENSDART00000137391   None 407 None 9
ENSDART00000145095   None 2065 None 21
Genomic Location:
Chromosome 8 (position 27063620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGATGAGCAGTCGGTCCCGCGAGCAGCTGGAGTCTAATGGTGGAGCA[C/T]AGCCCTGCAGAGAGTGGCTGAGGACCCTGCCGCCCCGCCAGCTCTCACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link