LOC563719

Ensembl ID:
ENSDARG00000055792
Human Orthologue:
FOXO4
Human Description:
forkhead box O4 [Source:HGNC Symbol;Acc:7139]
Mouse Orthologue:
Foxo4
Mouse Description:
forkhead box O4 Gene [Source:MGI Symbol;Acc:MGI:1891915]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31990 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078187 Essential Splice Site 153 619 1 3
Genomic Location (Zv9):
Chromosome 14 (position 31780175)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30570232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCGTATTTTAAGGACAAAGGAGATAGTAACAGTTCTGCAGGGTGGAAG[G/A]TAAGTCTGAGAAAGCACTGGCTGATAGCCTTTCTAAAGATGATAATAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link