ptpn3

Ensembl ID:
ENSDARG00000055784
ZFIN ID:
ZDB-GENE-030131-2934
Description:
Protein-tyrosine phosphatase H1 [Source:UniProtKB/TrEMBL;Acc:C7U144]
Human Orthologue:
PTPN4
Human Description:
protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) [Source:HGNC Symbol;Acc:9656]
Mouse Orthologue:
Ptpn4
Mouse Description:
protein tyrosine phosphatase, non-receptor type 4 Gene [Source:MGI Symbol;Acc:MGI:1099792]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42731 Nonsense Mutation detected in F1 DNA During 2017
sa16638 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078180 Nonsense 70 839 2 25
ENSDART00000141393 Nonsense 70 839 3 26
Genomic Location (Zv9):
Chromosome 16 (position 28810548)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26686322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATCTGCTCTTTGACTTGGCTTGTGAACACCTAAACATAGTGGAGAAA[C/T]AGTACTTCAGCATGCAGATCAGCGAGGACACGTCCAGTTCTCCGGTAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078180 Nonsense 128 839 5 25
ENSDART00000141393 Nonsense 128 839 6 26
Genomic Location (Zv9):
Chromosome 16 (position 28813166)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26688940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCAGTGARAGTTTCTTTTTACCCTTATTTTGTTTTTTAGGCATTTTTA[T/A]TTCTTGCAAATCAGGAAGGACATCTGTGAGGGAAGGTAAATCCTGAGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link