tmem115

Ensembl ID:
ENSDARG00000055763
ZFIN ID:
ZDB-GENE-050913-157
Description:
transmembrane protein 115 [Source:RefSeq peptide;Acc:NP_001028917]
Human Orthologue:
TMEM115
Human Description:
transmembrane protein 115 [Source:HGNC Symbol;Acc:30055]
Mouse Orthologue:
Tmem115
Mouse Description:
transmembrane protein 115 Gene [Source:MGI Symbol;Acc:MGI:1930765]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16080 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078161 Nonsense 166 361 2 3
ENSDART00000078163 Nonsense 166 361 2 3
ENSDART00000122479 Nonsense 166 361 1 7

The following transcripts of ENSDARG00000055763 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 26746953)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTAAAGCAGACTGCAGGTGACACTACAGTGCTTCGAGTTCCTCAAGTA[C/T]GATTAAAAGCTGCCCCGGCGCTAGCYTTGCTTGCCATARCWGWCCTGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h8kziu49