fosb

Ensembl ID:
ENSDARG00000055751
ZFIN ID:
ZDB-GENE-041114-181
Description:
protein fosB [Source:RefSeq peptide;Acc:NP_001007313]
Human Orthologue:
FOSB
Human Description:
FBJ murine osteosarcoma viral oncogene homolog B [Source:HGNC Symbol;Acc:3797]
Mouse Orthologue:
Fosb
Mouse Description:
FBJ osteosarcoma oncogene B Gene [Source:MGI Symbol;Acc:MGI:95575]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9219 Nonsense Mutation detected in F1 DNA During 2016
sa43149 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078151 Nonsense 162 234 2 3
ENSDART00000130206 Nonsense 183 352 3 6
ENSDART00000133487 Nonsense 183 411 3 5
ENSDART00000136463 Nonsense 183 198 3 3
Genomic Location:
Chromosome 18 (position 35112281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTTTCACCCCACCGAGCTCTGAYACTCCTGGCYCAGTGCGTCAGTCT[C/T]GAAGCCGCCGCCGTGCACGAGATGAAACGGTGAGTGGGACCCATTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078151   None 234 None 3
ENSDART00000130206 Nonsense 252 352 5 6
ENSDART00000133487 Nonsense 252 411 5 5
ENSDART00000136463   None 198 None 3
Genomic Location:
Chromosome 18 (position 35114085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGAAGGCCGAGCTAGAGGCTGAAATATCCGAGCTGCAGAAGGAGAAA[G/T]AGCGCCTGGAGTTTGTCCTGGTCGCCCACCAACCTGGTTGCAAACTTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link