foxp3a

Ensembl ID:
ENSDARG00000055750
ZFIN ID:
ZDB-GENE-061116-2
Description:
forkhead box P3a [Source:RefSeq peptide;Acc:NP_001076343]
Human Orthologue:
FOXP3
Human Description:
forkhead box P3 [Source:HGNC Symbol;Acc:6106]
Mouse Orthologue:
Foxp3
Mouse Description:
forkhead box P3 Gene [Source:MGI Symbol;Acc:MGI:1891436]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8316 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8316
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078149 Nonsense 155 350 6 13
ENSDART00000085779 Nonsense 155 419 6 14
ENSDART00000127237 None None 278 None 10
Genomic Location:
Chromosome 8 (position 26573020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGAATCGGTGCTTATGCGTCAAGCCCTCAGCCTGGCAGCCCGGAGTA[T/A]ACTGGGAAGTGAGTATGTAGTTTGAGAAAACAAACACAAATTAGGATATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/93763c7p