si:ch211-238g23.1

Ensembl ID:
ENSDARG00000055746
ZFIN ID:
ZDB-GENE-050420-173
Description:
Novel protein kinase domain containing protein [Source:UniProtKB/TrEMBL;Acc:A3KQ71]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25070 Nonsense Mutation detected in F1 DNA During 2017
sa25071 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059289 Nonsense 26 287 1 6
ENSDART00000147656 Nonsense 426 693 4 9
Genomic Location (Zv9):
Chromosome 18 (position 35256984)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36936140
KASP Assay ID:
554-7576.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGAAGGAGCGTTTGGCCAGGTGTTTGTGGCATCTTACAAACTTCGT[A/T]AAAGAGTAAAGGTAGAGAACTACTATTTACATTCAGTCAACATTTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25071
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059289 Missense 47 287 2 6
ENSDART00000147656 Essential Splice Site 446 693 5 9
Genomic Location (Zv9):
Chromosome 18 (position 35257147)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36936303
KASP Assay ID:
554-7857.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCCTGAAGTTTATCTACAAGAGTTTCGACGACCGCTATCTTGACATT[G/A]TAAGTTGAATAAATCACACAACAGTGAAAATGTGCCGACCATTAACTCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link