ribc1

Ensembl ID:
ENSDARG00000055739
ZFIN ID:
ZDB-GENE-081031-7
Description:
RIB43A-like with coiled-coils protein 1 [Source:RefSeq peptide;Acc:NP_001074132]
Human Orthologue:
RIBC1
Human Description:
RIB43A domain with coiled-coils 1 [Source:HGNC Symbol;Acc:26537]
Mouse Orthologue:
Ribc1
Mouse Description:
RIB43A domain with coiled-coils 1 Gene [Source:MGI Symbol;Acc:MGI:1913861]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18196 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18196
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078141 Essential Splice Site 67 381 1 7
Genomic Location:
Chromosome 23 (position 28935005)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAACAAGAACGAAAAGAAATGGAAAAGCAGAGAGACGTTTCTTATGG[T/A]AAGACTCATACATAAACTTTGAGGGCTGTTGTCTTTTTCACGGCAACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9eum328y