ube3a

Ensembl ID:
ENSDARG00000055737
ZFIN ID:
ZDB-GENE-041114-190
Description:
ubiquitin-protein ligase E3A [Source:RefSeq peptide;Acc:NP_001007319]
Human Orthologue:
UBE3A
Human Description:
ubiquitin protein ligase E3A [Source:HGNC Symbol;Acc:12496]
Mouse Orthologue:
Ube3a
Mouse Description:
ubiquitin protein ligase E3A Gene [Source:MGI Symbol;Acc:MGI:105098]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9479 Nonsense Available for shipment Available now
sa18845 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9479
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078128 Nonsense 53 857 3 11
ENSDART00000078128 Nonsense 53 857 3 11

The following transcripts of ENSDARG00000055737 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 38709095)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCAGCGCATGGATAACAATGCAGCAGCCATCAAGGCCCTGGAGTTATA[T/A]AAGAATAATGCCAAACTGTGTGATCCTCATCCCTCTAAGAAAGGAGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078128 Nonsense 53 857 3 11
ENSDART00000078128 Nonsense 53 857 3 11

The following transcripts of ENSDARG00000055737 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 38709095)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGCGCATGGATAACAATGCAGCAGCCATCAAGGCCCTGGAGTTATA[T/A]AAGAATAATGCCAAACTGTGTGATCCTCATCCCTCTAAGAAAGGAGCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l481ogs0