dnah1

Ensembl ID:
ENSDARG00000055736
ZFIN ID:
ZDB-GENE-081015-3
Human Orthologue:
DNAH1
Human Description:
dynein, axonemal, heavy chain 1 [Source:HGNC Symbol;Acc:2940]
Mouse Orthologue:
Dnahc1
Mouse Description:
dynein, axonemal, heavy chain 1 Gene [Source:MGI Symbol;Acc:MGI:107721]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31843 Nonsense Available for shipment Available now
sa35130 Nonsense Mutation detected in F1 DNA During 2017
sa41883 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31843
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077928 Nonsense 282 2635 7 49
Genomic Location (Zv9):
Chromosome 11 (position 35528466)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34420682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTCTGAAAGGCCAGCCCTCAGTTAGCGGAGGAGAATATGAGGCTGTA[C/T]AGACCTATGTGCTTAATCCAAAGTCCATCACCATGGGGCAGCTTTACGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077928 Nonsense 342 2635 8 49
Genomic Location (Zv9):
Chromosome 11 (position 35527766)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34419982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAAAGAAGTGGTACATGTTTGACGGGCCTGTAGATGCCGTGTGGATC[G/T]AGAACATGAACACAGTTCTGGATGACAACAAGAAACTGTGTCTGAGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077928 Essential Splice Site 660 2635 14 49
Genomic Location (Zv9):
Chromosome 11 (position 35524815)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34417031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCCGCCAACCAGACACAAGACTATATTGACAGCAAACTGGATAGGAG[G/A]TTTTTGTTTCTCTAATCAGTCTTTTAATTCTCTGTATATATTATTTTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link