bco2a

Ensembl ID:
ENSDARG00000055722
ZFIN ID:
ZDB-GENE-030131-8039
Description:
Novel protein similar to beta-carotene oxygenase 2a (Bco2a) [Source:UniProtKB/TrEMBL;Acc:B8JLH3]
Human Orthologue:
BCO2
Human Description:
beta-carotene oxygenase 2 [Source:HGNC Symbol;Acc:18503]
Mouse Orthologue:
Bco2
Mouse Description:
beta-carotene oxygenase 2 Gene [Source:MGI Symbol;Acc:MGI:2177469]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13144 Nonsense Available for shipment Available now
sa1284 Essential Splice Site F2 line generated During 2014
sa20447 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078117 Nonsense 145 535 3 11
ENSDART00000133981 Nonsense 178 569 4 12
ENSDART00000147963 Nonsense 180 257 5 7

The following transcripts of ENSDARG00000055722 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 31704610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCAACAGATAATGCCAGCGTCAACTTTGTTAAGTACAAGGGGGACTA[T/A]TATGTGAGCACWRAGACAAACTACATGCACAGAGTGGATCCAGAAACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1284
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078117 Essential Splice Site 245 535 6 11
ENSDART00000133981 Essential Splice Site 278 569 7 12
ENSDART00000147963 None None 257 None 7

The following transcripts of ENSDARG00000055722 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 31701418)
KASP Assay ID:
554-1199.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTMTGAATGTATAGCACTAAAACACATANATTTTATTTCCCTGAACCTTTC[A/T]GGCATGTCAGAGAACTACGTAGTGTTCATCGAGCAGCCTATTATAATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078117 Nonsense 381 535 8 11
ENSDART00000133981 Nonsense 414 569 9 12
ENSDART00000147963 None None 257 None 7

The following transcripts of ENSDARG00000055722 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 31699783)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGTCGTTTTGTTCTGCCGCTCCACATCAGCAGTGAAACACCTCTGGAA[C/T]AGAATCTCAACACTCGTCTTGACAGCACCGCCACTGCCATCTGCCGCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oswbnlfd