capn8

Ensembl ID:
ENSDARG00000055715
ZFIN ID:
ZDB-GENE-050522-279
Description:
Novel calpain family protein (Zgc:112467) [Source:UniProtKB/TrEMBL;Acc:A5WWC4]
Mouse Orthologue:
Capn8
Mouse Description:
calpain 8 Gene [Source:MGI Symbol;Acc:MGI:2181366]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5973 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078111 Essential Splice Site 544 701 14 21
ENSDART00000144585 Essential Splice Site 544 700 14 21
Genomic Location:
Chromosome 22 (position 27216016)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATATAGACCCACATTTCAAACGCCTCTTCAGTCARGTTGCTGGAAGCG[T/A]AAGTCACAACTGGTCAATATAAATTTGAATCATTATCATGATTTTTCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f9cgr9xf