FMNL1 (1 of 2)

Ensembl ID:
ENSDARG00000055713
Description:
formin-like 1 [Source:HGNC Symbol;Acc:1212]
Human Orthologue:
FMNL1
Human Description:
formin-like 1 [Source:HGNC Symbol;Acc:1212]
Mouse Orthologue:
Fmnl1
Mouse Description:
formin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1888994]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6040 Nonsense Mutation detected in F1 DNA During 2016
sa3326 Essential Splice Site Available for shipment Available now
sa10153 Essential Splice Site Available for shipment Available now
sa18761 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5729 Essential Splice Site F2 line generated During 2016
sa33252 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Nonsense 261 1125 8 31
Genomic Location (Zv9):
Chromosome 3 (position 37209239)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37072599
KASP Assay ID:
554-3674.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTTTTTTTCCCAAACAGTCTGGGTTTAATTTAGTCATGACACACCCT[A/T]GATGTGTCAACGAAATCACACTTAGTCTCAACAACAAAAACCCCAGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 627 1125 17 31
Genomic Location (Zv9):
Chromosome 3 (position 37215334)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37078694
KASP Assay ID:
554-2620.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCACCACCTCCACCTCCTCCMCCCCCTCCACTACCTGGCGCTKAAGC[A/T]CCTCCTCCTCCTCCACCACCTCCTCCTCCTTCTGGAAGTGGAGGTGCTCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 632 1125 18 31
ENSDART00000083495 Essential Splice Site 632 1125 18 31
Genomic Location (Zv9):
Chromosome 3 (position 37215380)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37078740
KASP Assay ID:
2259-3851.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCWCCTCCTCCTCCTCCACCACCTCCTCCTCCTTCTGGAAGTGGAGGT[G/A]CTCCTCCCCCTCCCCCTCCGCCMCCTCCCCCTGGTGGAGGTCCACCACCM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 632 1125 18 31
ENSDART00000083495 Essential Splice Site 632 1125 18 31
Genomic Location (Zv9):
Chromosome 3 (position 37215380)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37078740
KASP Assay ID:
2259-3851.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCACCTCCTCCTCCTCCACCACCTCCTCCTCCTTCTGGAAGTGGAGGT[G/A]CTCCTCCCCCTCCCCCTCCGCCACCTCCCCCTGGTGGAGGTCCACCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5729
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 654 1125 20 31
Genomic Location (Zv9):
Chromosome 3 (position 37215650)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37079010
KASP Assay ID:
554-3489.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTGAGCACTCTACACTGAGCCTGGTGACTGTATATCCATTTTTTCTG[G/C]TGTTTTACACAGGACCAAAGGCACGCAAAAYAATTCAGACAAAGTTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 992 1125 26 31
Genomic Location (Zv9):
Chromosome 3 (position 37224357)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 37087717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGTGATGTATTAGACTCCCTCGTTAAAGATGGCAAAACAGCACAGG[T/C]GAGACCCCAGGAACACACTCAGAAACACACACACTGTACTATAAATGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link