FMNL1 (1 of 2)

Ensembl ID:
ENSDARG00000055713
Description:
formin-like 1 [Source:HGNC Symbol;Acc:1212]
Human Orthologue:
FMNL1
Human Description:
formin-like 1 [Source:HGNC Symbol;Acc:1212]
Mouse Orthologue:
Fmnl1
Mouse Description:
formin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1888994]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6040 Nonsense Mutation detected in F1 DNA During 2014
sa5217 Nonsense Mutation detected in F1 DNA During 2014
sa2140 Nonsense Mutation detected in F1 DNA During 2014
sa3326 Essential Splice Site Available for shipment Available now
sa10153 Essential Splice Site Available for shipment Available now
sa18761 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5729 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa6040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Nonsense 261 1125 8 31
Genomic Location:
Chromosome 3 (position 37209239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTTTTTTTCCCAAACAGTCTGGGTTTAATTTAGTCATGACACACCCT[A/T]GATGTGTCAACGAAATCACACTTAGTCTCAACAACAAAAACCCCAGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Nonsense 480 1125 14 31
Genomic Location:
Chromosome 3 (position 37214200)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACAGAGAGAAGGGGAGTGAAAAAGAGTCCAAACTGGAGAAAAAACTC[A/T]AAGAACTGCAGGAGAAAGGCTTACTTCGACTGGAGCGCACAGYCTCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Nonsense 626 1125 17 31
Genomic Location:
Chromosome 3 (position 37215329)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCYGCAGCACCACCTCCACCTCCTCCMCCCCCTCCACTACCTGGCGCT[G/T]AAGCWCCTCCTCCTCCTCCACCACCTCCTCCTCCTTCTGGAAGTGGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 627 1125 17 31
Genomic Location:
Chromosome 3 (position 37215334)
KASP Assay ID:
554-2620.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCACCACCTCCACCTCCTCCMCCCCCTCCACTACCTGGCGCTKAAGC[A/T]CCTCCTCCTCCTCCACCACCTCCTCCTCCTTCTGGAAGTGGAGGTGCTCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 632 1125 18 31
ENSDART00000083495 Essential Splice Site 632 1125 18 31
Genomic Location:
Chromosome 3 (position 37215380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCWCCTCCTCCTCCTCCACCACCTCCTCCTCCTTCTGGAAGTGGAGGT[G/A]CTCCTCCCCCTCCCCCTCCGCCMCCTCCCCCTGGTGGAGGTCCACCACCM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 632 1125 18 31
ENSDART00000083495 Essential Splice Site 632 1125 18 31
Genomic Location:
Chromosome 3 (position 37215380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCACCTCCTCCTCCTCCACCACCTCCTCCTCCTTCTGGAAGTGGAGGT[G/A]CTCCTCCCCCTCCCCCTCCGCCACCTCCCCCTGGTGGAGGTCCACCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5729
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083495 Essential Splice Site 654 1125 20 31
Genomic Location:
Chromosome 3 (position 37215650)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTGAGCACTCTACACTGAGCCTGGTGACTGTATATCCATTTTTTCTG[G/C]TGTTTTACACAGGACCAAAGGCACGCAAAAYAATTCAGACAAAGTTCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mxbbmnsu