sdhda

Ensembl ID:
ENSDARG00000055712
ZFIN ID:
ZDB-GENE-040718-192
Description:
Succinate dehydrogenase [ubiquinone] cytochrome b small subunit A, mitochondrial [Source:UniProtKB/S
Human Orthologues:
AP002884.2, SDHD
Human Description:
succinate dehydrogenase complex, subunit D, integral membrane protein [Source:HGNC Symbol;Acc:10683]
Mouse Orthologue:
Sdhd
Mouse Description:
succinate dehydrogenase complex, subunit D, integral membrane protein Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33626 Nonsense Available for shipment Available now
sa20448 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078115 Nonsense 39 154 2 4
ENSDART00000134209 Nonsense 39 59 2 3
Genomic Location (Zv9):
Chromosome 5 (position 31726673)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29487503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAACTGTCTCGAGGGTCAGCCTGTCCGAGGATTGGAGATGTGGACTA[T/A]ACAGAGCCAGCAGGCAGGATCCACACAGCTTCATCAAGCACTGGTGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078115 Essential Splice Site 100 154 None 4
ENSDART00000134209 Essential Splice Site 54 59 None 3
Genomic Location (Zv9):
Chromosome 5 (position 31720769)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29481599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAAATGTTTTAGTTAATTCACTCTTTTTCTGTGTTTTTCTATTTCTGC[A/T]GGGGTATTGGTCAAGTCCTGACAGACTATGTTCACGGTGAAGTTAAGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link