f5

Ensembl ID:
ENSDARG00000055705
ZFIN ID:
ZDB-GENE-030131-5531
Description:
coagulation factor V [Source:RefSeq peptide;Acc:NP_001007209]
Human Orthologue:
F5
Human Description:
coagulation factor V (proaccelerin, labile factor) [Source:HGNC Symbol;Acc:3542]
Mouse Orthologue:
F5
Mouse Description:
coagulation factor V Gene [Source:MGI Symbol;Acc:MGI:88382]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13037 Nonsense Available for shipment Available now
sa21530 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21531 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8345 Nonsense Mutation detected in F1 DNA During 2014
sa7198 Nonsense Mutation detected in F1 DNA During 2014
sa5551 Nonsense Mutation detected in F1 DNA During 2014
sa13751 Nonsense Available for shipment Available now
sa13402 Essential Splice Site Available for shipment Available now
sa2508 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa13037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078065 Nonsense 66 2101 2 25
ENSDART00000128539 None None 406 2 26
Genomic Location:
Chromosome 9 (position 35101085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAATCATATAAAAAAGTAGTATACAGGGAATATAATGAGGGATTCAAA[C/T]AGCCAAAAGCTCATCCCTTGTCCTCAGGTAYACCGRTCACTTAACTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078065 Essential Splice Site 75 2101 None 25
ENSDART00000128539 Essential Splice Site None 406 None 26
Genomic Location:
Chromosome 9 (position 35101193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTATAAAGCAAAGCATGAATCTAACAATTGCTCAAAACAAATGTTCT[A/G]GGGTTACTTGGGCCTACATTGCGTGGACAAGAGGGTGACACAATCATCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078065 Essential Splice Site 115 2101 3 25
ENSDART00000128539 Essential Splice Site None 406 3 26
Genomic Location:
Chromosome 9 (position 35101318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTGCAGCCTCCACCCCCATGGCATTGCTTACGGGAAGCAGTCAGAGG[G/T]TGTGTATTCAGATGTGATTGCGGTAACAGTATGACCCATGTAGCAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078065 Nonsense 325 2101 7 25
ENSDART00000128539 None None 406 7 26
Genomic Location:
Chromosome 9 (position 35106910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGATTATCWTGTGTGTAGCTGGTTTGCACGGGTACCTAAAKATCAGG[A/T]AGTGTGATGAGTATACGGCGCCAAAAAGACGGCTTACCATTGAACAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078065 Nonsense 630 2101 12 25
ENSDART00000128539 None None 406 12 26
Genomic Location:
Chromosome 9 (position 35110453)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTACATCCAGACTGCTACTTTCTATGGTCATACATTTGAGCTAAAAAAC[A/T]GAGAAGAGGATATACTCAGTCTATTTCCTATGACKGGTGAAACTATCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078065 Nonsense 692 2101 13 25
ENSDART00000128539 None None 406 13 26
Genomic Location:
Chromosome 9 (position 35110768)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTYGAATGCTTCAGAGATTATGTAATAGAATATGWTTATGAGGAYGGG[A/T]AATTCACTGCATGGAAACCACCGACTATTAATGAAATCAAAAAAGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078065 Nonsense 799 2101 13 25
ENSDART00000128539 None None 406 13 26
Genomic Location:
Chromosome 9 (position 35111089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGTTTATTAATGGAGGAAGGWGATTTAGACAAGGGAGAATCTTCTAAT[A/T]AAGWCTTGAATGACAGCACWGACAAGKCATTGCTAGAGACAACAACTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078065 Essential Splice Site 1467 2101 None 25
ENSDART00000128539 Essential Splice Site None 406 None 26
Genomic Location:
Chromosome 9 (position 35114295)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACRTTTTMAATAAATRAATCTAAARCTAATTTGCTAATTCCTGTTTGCAA[A/C]GGCGACTTGATAAAACAGCTCAAAATGAGAGGCCCACGGTTTTCAGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2508
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078065 Nonsense 1489 2101 14 25
ENSDART00000128539 None None 406 14 26
Genomic Location:
Chromosome 9 (position 35114363)
KASP Assay ID:
554-3064.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCAAAATGAGAGGCCCACGGTTTTCAGAAAAGTGGTGTTCCGAAGGTA[C/A]CTGGACAGCACCTTTAGCATCCGAGACATCCGAGGAGAAATGGACGAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4mvijy0s