si:ch211-120p12.4

Ensembl ID:
ENSDARG00000055698
ZFIN ID:
ZDB-GENE-090312-150
Description:
Novel protein similar to vertebrate pecanex-like 3 (Drosophila) (PCNXL3) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
PCNXL2
Human Description:
pecanex-like 2 (Drosophila) [Source:HGNC Symbol;Acc:8736]
Mouse Orthologue:
Pcnxl2
Mouse Description:
pecanex-like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2445010]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa661 Nonsense F2 line generated During 2017
sa28106 Nonsense Mutation detected in F1 DNA During 2017
sa11440 Nonsense Available for shipment Available now
sa5859 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31929 Essential Splice Site Available for shipment Available now
sa35478 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42195 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017
sa42196 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017
sa22287 Nonsense Available for shipment Available now
sa17666 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa661
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078079 Nonsense 215 2005 5 34
ENSDART00000134973   None 203 None 5
ENSDART00000144215   None 1437 None 28
Genomic Location (Zv9):
Chromosome 13 (position 23899155)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23544815
KASP Assay ID:
554-0569.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACCAGTCTGCCCCTCTCCTCCAGGGAGAGCAGATTCCTTCAGCCCAC[A/T]GAGACAAAGCTGAGGAAGATCTACCACCTACACCTACCAACGAAGACGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa28106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078079 Nonsense 314 2005 5 34
ENSDART00000134973   None 203 None 5
ENSDART00000144215   None 1437 None 28
Genomic Location (Zv9):
Chromosome 13 (position 23899452)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23545112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGAGGAGTCTGTCAAACAGAGCATCTTACAGTCAGCCCAATCCCAC[C/T]AGGGAGATTCAGACTGTCCTGTCAAAATTCCTGTCATCACTTTTGACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078079 Nonsense 943 2005 16 34
ENSDART00000134973   None 203 None 5
ENSDART00000144215 Nonsense 372 1437 10 28
Genomic Location (Zv9):
Chromosome 13 (position 23908977)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23554637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCCAGCTCTTTTCTCTGGTTTCTGTGCTCTGCTAGTGGTCGTCTCCTA[T/A]CATCTKAGCCGACAAAGCAGTGATCCATCAGTGTTATTGTAAGAACATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078079 Essential Splice Site 993 2005 18 34
ENSDART00000134973   None 203 None 5
ENSDART00000144215 Essential Splice Site 420 1437 12 28
Genomic Location (Zv9):
Chromosome 13 (position 23909935)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23555595
KASP Assay ID:
554-3663.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCATTCYTTTCTAAATTATATTTTAAAATCAATGTATTTTGTTGTTAC[A/G]GAAAGAGATTTTACTGTCAGATCTGGTTGTTTGCAGTCTGGCCTCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078079 Essential Splice Site 1023 2005 18 34
ENSDART00000134973   None 203 None 5
ENSDART00000144215 Essential Splice Site 450 1437 12 28
Genomic Location (Zv9):
Chromosome 13 (position 23910030)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23555690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTTTGACCTTTGCAATTACTGCCAGCACGGTTTTCCTGTCTCTAAGA[G/T]TGAGTTTCTCTTACTTGTTACATTTCTTACACACAACCTCTTCATAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078079 Essential Splice Site 1023 2005 18 34
ENSDART00000134973   None 203 None 5
ENSDART00000144215 Essential Splice Site 450 1437 12 28
Genomic Location (Zv9):
Chromosome 13 (position 23910031)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23555691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTTGACCTTTGCAATTACTGCCAGCACGGTTTTCCTGTCTCTAAGAG[T/A]GAGTTTCTCTTACTTGTTACATTTCTTACACACAACCTCTTCATAATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078079 Essential Splice Site 1217 2005 None 34
ENSDART00000134973   None 203 None 5
ENSDART00000144215 Splice Site 644 1437 16 28
Genomic Location (Zv9):
Chromosome 13 (position 23919058)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23564718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGGGGTAGTGCATTTCATGCATTTGCACAACCCTTTGCTGTACCTCA[T/C]ATCCTTTACAATATGTCCAGCTTCAGTGTTTTTATTGGCGGCATAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078079 Splice Site 1217 2005 23 34
ENSDART00000134973   None 203 None 5
ENSDART00000144215 Essential Splice Site 645 1437 17 28
Genomic Location (Zv9):
Chromosome 13 (position 23919200)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23564860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACCTCCAGATGTTTTGCATATATTTGTTCTTGACGGATGATCTCAGA[C/T]TCTGCCATGCTGCTGCTGCAGACGTTCATCACCACGCTCTTCTACACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078079 Nonsense 1537 2005 28 34
ENSDART00000134973   None 203 None 5
ENSDART00000144215 Nonsense 964 1437 22 28
Genomic Location (Zv9):
Chromosome 13 (position 23928705)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23574365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATTCTCCCCTGGTTACTCTGTGTTTCGCTCTGTCTGTGCTTGGCCGC[A/T]GATCCCTCAGTACAGCAGCACACAACAGATCCAACAGGTACAACATTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078079 Essential Splice Site 1597 2005 29 34
ENSDART00000134973   None 203 None 5
ENSDART00000144215 Essential Splice Site 1024 1437 23 28
Genomic Location (Zv9):
Chromosome 13 (position 23929058)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23574718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGATGGTTGTGGCCCCAGCCGTGAGAATGAGTCTGAAACTTCACCAGG[T/C]GAGATGAACACTCTCCTTTTSTTTTCRGCTTAGWCCCTTTAATAATCTKG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Transferability of type 2 diabetes implicated loci in multi-ethnic cohorts from Southeast Asia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link