ENSDARG00000055683

Ensembl ID:
ENSDARG00000055683

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28456 Nonsense Mutation detected in F1 DNA During 2016
sa22649 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa28456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078059 Nonsense 52 292 4 7
Genomic Location (Zv9):
Chromosome 15 (position 24435147)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25102220
GRCz10 15 25146334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTATAAAATCCATCACTTGATTGGTCAGGGATCAACAGGAGTCATCTA[T/A]GATGGAATTCGTCTGTCGGATTGCCGAATGGTTTGTTTCAGACATAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078059 Essential Splice Site 63 292 5 7
Genomic Location (Zv9):
Chromosome 15 (position 24434920)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25146107
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAAAGGATCACGATTGTAAGTACACACTCGCAACATTGTTAAAAATA[G/A]TCTCCAGTTCAGTTCAATCACATCTCACTAATACGTCTATTATCTCTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link