akap12

Ensembl ID:
ENSDARG00000055678
ZFIN ID:
ZDB-GENE-030131-9753
Description:
A-kinase anchor protein 12 [Source:RefSeq peptide;Acc:NP_001091654]
Human Orthologue:
AKAP12
Human Description:
A kinase (PRKA) anchor protein 12 [Source:HGNC Symbol;Acc:370]
Mouse Orthologue:
Akap12
Mouse Description:
A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa72 Nonsense Confirmed mutation in F2 line During 2014
sa15047 Nonsense Available for shipment Available now
sa4094 Nonsense Mutation detected in F1 DNA During 2014
sa4092 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa72
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078072 None None 207 None 3
ENSDART00000110883 Nonsense 191 1533 2 3
Genomic Location:
Chromosome 20 (position 26445860)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAACAGGGACAATATCAGAGAAAGAACCAGAGCCAGAAGTGCCAGCT[G/T]AATCGCCCACAAGCCCACCCTCTCAGGAGACACAGAGTCCCTTTAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078072 None None 207 None 3
ENSDART00000110883 Nonsense 552 1533 2 3
Genomic Location:
Chromosome 20 (position 26444777)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAGAGTCACAGGCAGAATCTAAGACAGAACCAAAAGCTGAGAAGTCT[G/T]AAYCTGTTGCAGAAGAGCCAAAGAGAAAAATGGATACATCTGTGTCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078072 None None 207 None 3
ENSDART00000110883 Nonsense 721 1533 2 3
Genomic Location:
Chromosome 20 (position 26444268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAGAGGATGACTCTGATACTCCAGCTGTGGTGCCTCTTTCAGAATA[T/A]GACAGCGAACCATCTGCAGAAGCTGCAGTTAAGGCAGAGGAGGTAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4092
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078072 None None 207 None 3
ENSDART00000110883 Nonsense 892 1533 2 3
Genomic Location:
Chromosome 20 (position 26443757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTTGCCATCACCACTGATGCTCTTCTGGTTGAGTCTGCCACCAAAGAA[C/T]AGAAAACAGTCTTGGTGGCGCATGAGAAAAACGAGGCAGTGGCTGTTTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l0ljuokn