map3k10

Ensembl ID:
ENSDARG00000055672
ZFIN ID:
ZDB-GENE-050419-112
Description:
Novel protein similar to vertebrate mitogen-activated protein kinase kinase kinase family [Source:Un
Human Orthologue:
MAP3K10
Human Description:
mitogen-activated protein kinase kinase kinase 10 [Source:HGNC Symbol;Acc:6849]
Mouse Orthologue:
Map3k10
Mouse Description:
mitogen-activated protein kinase kinase kinase 10 Gene [Source:MGI Symbol;Acc:MGI:1346879]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5640 Essential Splice Site F2 line generated During 2016
sa2969 Essential Splice Site F2 line generated During 2016
sa9813 Nonsense Available for shipment Available now
sa14946 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5640
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088309 Essential Splice Site 405 1062 3 11
ENSDART00000136432 Essential Splice Site 328 973 3 11
ENSDART00000088309 Essential Splice Site 405 1062 3 11
ENSDART00000136432 Essential Splice Site 328 973 3 11
Genomic Location (Zv9):
Chromosome 18 (position 35303262)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36982418
KASP Assay ID:
554-3073.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCCATCCCCTCCACCTGCCCTGAAGCCTTTGCCCAGCTGCTGGGAGG[T/G]AAGGACAGTCTTTGTTGAGTAATTGTCCTGCAAGGCATCCACTGTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2969
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088309 Essential Splice Site 405 1062 3 11
ENSDART00000136432 Essential Splice Site 328 973 3 11
ENSDART00000088309 Essential Splice Site 405 1062 3 11
ENSDART00000136432 Essential Splice Site 328 973 3 11
Genomic Location (Zv9):
Chromosome 18 (position 35303262)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36982418
KASP Assay ID:
554-3073.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCCATCCCCTCCACCTGCCCTGAAGCCTTTGCCCAGCTGCTGGGAGG[T/G]AAGGACAGTCTTTGTTGAGTAATTGTCCTGCAAGGCATCCACTGTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088309 Nonsense 554 1062 6 11
ENSDART00000136432 Nonsense 477 973 6 11
Genomic Location (Zv9):
Chromosome 18 (position 35297182)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36976338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTCTAACAGCATCTGTTTGTTTWAGGTTTTGAGCATAAGATCACAGTG[C/T]AAGCTTCGCCCAGTGTGGACAAGAGGAARTGTCAGRGTAGTGAAAGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14946
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088309 Essential Splice Site 669 1062 8 11
ENSDART00000136432 Essential Splice Site 592 973 8 11
Genomic Location (Zv9):
Chromosome 18 (position 35294399)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36973555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAAMATGCTCCTATGACAGCTGGATTCTCAAGCCTAAWTGAAATGGG[T/A]GAGGATGAATCATGTTYAACWTACAGACACAATAAACCCACCTCAGGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link