pdzd3b

Ensembl ID:
ENSDARG00000055656
ZFIN ID:
ZDB-GENE-081022-151
Description:
PDZ domain containing 3 [Source:RefSeq peptide;Acc:NP_001124259]
Human Orthologue:
PDZD3
Human Description:
PDZ domain containing 3 [Source:HGNC Symbol;Acc:19891]
Mouse Orthologue:
Pdzd3
Mouse Description:
PDZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2429554]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33631 Nonsense Mutation detected in F1 DNA During 2017
sa12592 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078049 Nonsense 213 524 5 10
Genomic Location (Zv9):
Chromosome 5 (position 32333272)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30094102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGATTGATGGTGCCATGGCCTCTGAACTCACACATTCTGCCATCAGC[A/T]AAATGGTAAGAACTTGCTTTAGATAAACTGCAAAGCATTTTTACTCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078049 Essential Splice Site 424 524 9 10
Genomic Location (Zv9):
Chromosome 5 (position 32336107)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 30096937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAYAAACATCCYTTTTGCTTTTACTATAGYAACATGCATTACATGTTT[A/T]GGTAGCGGCAGGCRGTCCAGGACAGAGTTCAGGTCTCTTTCAMGGTGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link