ACLY (2 of 2)

Ensembl ID:
ENSDARG00000055652
Description:
ATP citrate lyase [Source:HGNC Symbol;Acc:115]
Human Orthologue:
ACLY
Human Description:
ATP citrate lyase [Source:HGNC Symbol;Acc:115]
Mouse Orthologue:
Acly
Mouse Description:
ATP citrate lyase Gene [Source:MGI Symbol;Acc:MGI:103251]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41986 Nonsense Mutation detected in F1 DNA During 2016
sa18271 Essential Splice Site Available for shipment Available now
sa14734 Essential Splice Site Available for shipment Available now
sa41985 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6242 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35232 Nonsense Mutation detected in F1 DNA During 2016
sa41984 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078037 Nonsense 68 1096 2 27
Genomic Location (Zv9):
Chromosome 12 (position 15180278)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 14035931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTTTACTTGTGCAGAGGCTAGTTGTGAAGCCAGATCAACTGATTAAA[C/T]GAAGAGGAAAGCTGGGATTGGTAGCAGTTGACCTGAAACTTGAGAGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078037 Essential Splice Site 292 1096 8 27
Genomic Location (Zv9):
Chromosome 12 (position 15150669)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 14006322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAACATAAACAGAACAGATAAYAAACGTGACCTCGTTATATYTGTTTTA[G/A]TGACACTATATGTGATCTGGGTGGAGTAGATGAGTTGGCCAACTATGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078037 Essential Splice Site 358 1096 9 27
Genomic Location (Zv9):
Chromosome 12 (position 15145850)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 14001503
KASP Assay ID:
2260-5132.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATYGGTGGCAGTATTGCTAACTTCACAAATGTAGCAGCAACTTTTAAG[G/A]TTAGACTATACGGCTTGWTCTAGATATTGATAGAGTATTGAYATATTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078037 Essential Splice Site 398 1096 11 27
Genomic Location (Zv9):
Chromosome 12 (position 15143799)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13999452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACAAATAATCTTATCTAATCTTTTTGTTTCTTTGTTTCCTTTTTGTT[G/T]CAATAGGAAAGACTACTGGTATTCCCATTCATGTCTTTGGCACAGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078037 Essential Splice Site 529 1096 14 27
Genomic Location (Zv9):
Chromosome 12 (position 15126959)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13982612
KASP Assay ID:
554-4118.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTAATTTTGAAAGCATGGTTTTATGATTTTTCATTTTTRTGTGTGCC[A/G]GTGGTGACCACAAGCAGAAATTTTACTGGGGTCAWAAGGAGATCTTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078037 Nonsense 572 1096 14 27
Genomic Location (Zv9):
Chromosome 12 (position 15126829)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13982482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAACATCCAGATGTTGACGTACTCATTAACTTTGCCTCCCTTCGCT[C/A]AGCCTTCGACAGTACCATGGAAACACTTCAGTACCCTCAGGTAATATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078037 Nonsense 872 1096 21 27
Genomic Location (Zv9):
Chromosome 12 (position 15098462)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13954115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTGTTTAAAGAGGAAATGGGTGTCGGAGGAGTGCTGGGCCTGTTGTG[G/A]TTCCAGAGGAGGTTTGTCATTTAAAATTGGATCATTATGAAAATACAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link