ACLY (2 of 2)

Ensembl ID:
ENSDARG00000055652
Description:
ATP citrate lyase [Source:HGNC Symbol;Acc:115]
Human Orthologue:
ACLY
Human Description:
ATP citrate lyase [Source:HGNC Symbol;Acc:115]
Mouse Orthologue:
Acly
Mouse Description:
ATP citrate lyase Gene [Source:MGI Symbol;Acc:MGI:103251]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18271 Essential Splice Site Available for shipment Available now
sa14734 Essential Splice Site Available for shipment Available now
sa6242 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078037 Essential Splice Site 292 1096 8 27
Genomic Location:
Chromosome 12 (position 15150669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAACATAAACAGAACAGATAAYAAACGTGACCTCGTTATATYTGTTTTA[G/A]TGACACTATATGTGATCTGGGTGGAGTAGATGAGTTGGCCAACTATGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078037 Essential Splice Site 358 1096 9 27
Genomic Location:
Chromosome 12 (position 15145850)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATYGGTGGCAGTATTGCTAACTTCACAAATGTAGCAGCAACTTTTAAG[G/A]TTAGACTATACGGCTTGWTCTAGATATTGATAGAGTATTGAYATATTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078037 Essential Splice Site 529 1096 14 27
Genomic Location:
Chromosome 12 (position 15126959)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTAATTTTGAAAGCATGGTTTTATGATTTTTCATTTTTRTGTGTGCC[A/G]GTGGTGACCACAAGCAGAAATTTTACTGGGGTCAWAAGGAGATCTTACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o6wjrz3p