cpd

Ensembl ID:
ENSDARG00000055648
ZFIN ID:
ZDB-GENE-081112-2
Human Orthologue:
CPD
Human Description:
carboxypeptidase D [Source:HGNC Symbol;Acc:2301]
Mouse Orthologue:
Cpd
Mouse Description:
carboxypeptidase D Gene [Source:MGI Symbol;Acc:MGI:107265]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2827 Nonsense Mutation detected in F1 DNA During 2014
sa19115 Nonsense Mutation detected in F1 DNA During 2014
sa13438 Essential Splice Site Available for shipment Available now
sa22648 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa19116 Nonsense Mutation detected in F1 DNA During 2014
sa2832 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Nonsense 115 1350 1 21
ENSDART00000078035 Nonsense 115 1350 1 21
Genomic Location:
Chromosome 15 (position 24110887)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCCAAATTCAAGTATGTGGGCAACATGCACGGAGACGAGACCGTGTCC[C/T]GACAGGTGTTGGTTTACCTGCTGGAGGACCTACTGGAGAAGTACGGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Nonsense 115 1350 1 21
ENSDART00000078035 Nonsense 115 1350 1 21
Genomic Location:
Chromosome 15 (position 24110887)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCAAATTCAAGTATGTGGGCAACATGCACGGAGACGAGACCGTGTCC[C/T]GACAGGTGTTGGTTTACCTGCTGGAGGACCTACTGGAGAAGTACGGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Essential Splice Site 1032 1350 15 21
Genomic Location:
Chromosome 15 (position 24137148)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTATTTTATGTGTGTCAATAACTTGTGATTCTTTATGTGTTTTTTTC[A/T]GTAGGTAATGCATCTCAGCGAGTTTCAGAACCTCAGCCAGAGACACGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Splice Site, Nonsense 1083 1350 16 21
Genomic Location:
Chromosome 15 (position 24137459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTAATAAATTCAGTTCTCAAGTTTGTTATTTGCTTCTCAATTTCAGTT[G/T]AAAATGATGACACACTGAGATATCTGGCCACTGTGTATGCTGATCACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Nonsense 1208 1350 19 21
ENSDART00000078035 Nonsense 1208 1350 19 21
Genomic Location:
Chromosome 15 (position 24141230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACGGTAAGCCCATCGTGGGTGCTGCAATTGTGTTGAACGGTGGTGTT[C/T]GAGTCTACACTAGTGAAGGAGGGTATTTCCATGCTCTTCTGGCTCCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Nonsense 1208 1350 19 21
ENSDART00000078035 Nonsense 1208 1350 19 21
Genomic Location:
Chromosome 15 (position 24141230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACGGTAAGCCCATCGTGGGTGCTGCAATTGTGTTGAACGGTGGTGTT[C/T]GAGTCTACACTAGTGAAGGAGGGTATTTCCATGCTCTTCTGGCTCCTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/15zqtgo5