cpd

Ensembl ID:
ENSDARG00000055648
ZFIN ID:
ZDB-GENE-081112-2
Human Orthologue:
CPD
Human Description:
carboxypeptidase D [Source:HGNC Symbol;Acc:2301]
Mouse Orthologue:
Cpd
Mouse Description:
carboxypeptidase D Gene [Source:MGI Symbol;Acc:MGI:107265]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32035 Nonsense Mutation detected in F1 DNA During 2016
sa13438 Essential Splice Site Available for shipment Available now
sa22648 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32035
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Nonsense 756 1350 10 21
Genomic Location (Zv9):
Chromosome 15 (position 24127902)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24839089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCCGCCAGTTGCGGATCTGCAGAAATACTGGGAACAAAACCGCAAAT[C/A]ACTTCTGCAGTTCATCCATCAGGTCTGACTCTTTTTAAAAAAAATTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Essential Splice Site 1032 1350 15 21
Genomic Location (Zv9):
Chromosome 15 (position 24137148)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24848335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTATTTTATGTGTGTCAATAACTTGTGATTCTTTATGTGTTTTTTTC[A/T]GTAGGTAATGCATCTCAGCGAGTTTCAGAACCTCAGCCAGAGACACGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078035 Splice Site, Nonsense 1083 1350 16 21
Genomic Location (Zv9):
Chromosome 15 (position 24137459)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24848646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTAATAAATTCAGTTCTCAAGTTTGTTATTTGCTTCTCAATTTCAGTT[G/T]AAAATGATGACACACTGAGATATCTGGCCACTGTGTATGCTGATCACCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link