LOC100148522

Ensembl ID:
ENSDARG00000055642
Human Orthologue:
GPT
Human Description:
glutamic-pyruvate transaminase (alanine aminotransferase) [Source:HGNC Symbol;Acc:4552]
Mouse Orthologue:
Gpt
Mouse Description:
glutamic pyruvic transaminase, soluble Gene [Source:MGI Symbol;Acc:MGI:95802]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4458 Nonsense Mutation detected in F1 DNA During 2014
sa22057 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078033 Nonsense 10 494 1 11
Genomic Location:
Chromosome 12 (position 15193488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACCAGAATTACTGTGAATACAGGGAGAAACTATGACTGAGAATGGGTG[T/A]GAGTATCATGAGAGAGTGTTGACGGTGGACACTATGAACCCAAACATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078033 Essential Splice Site 80 494 2 11
Genomic Location:
Chromosome 12 (position 15196065)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTGACTGCCATGCAATGGGCCAGAAACCCATTACCTTCTTCAGACAGG[T/C]GTGTTTTTGAGCTATTGTGCATGTCTTGCTATTTTCTGAGCAGTAGTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ad2sns9r