LOC100148522

Ensembl ID:
ENSDARG00000055642
Human Orthologue:
GPT
Human Description:
glutamic-pyruvate transaminase (alanine aminotransferase) [Source:HGNC Symbol;Acc:4552]
Mouse Orthologue:
Gpt
Mouse Description:
glutamic pyruvic transaminase, soluble Gene [Source:MGI Symbol;Acc:MGI:95802]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4458 Nonsense Mutation detected in F1 DNA During 2016
sa22057 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31865 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41987 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078033 Nonsense 10 494 1 11
Genomic Location:
Chromosome 12 (position 15193488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACCAGAATTACTGTGAATACAGGGAGAAACTATGACTGAGAATGGGTG[T/A]GAGTATCATGAGAGAGTGTTGACGGTGGACACTATGAACCCAAACATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078033 Essential Splice Site 80 494 2 11
Genomic Location:
Chromosome 12 (position 15196065)
KASP Assay ID:
2260-5135.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTGACTGCCATGCAATGGGCCAGAAACCCATTACCTTCTTCAGACAGG[T/C]GTGTTTTTGAGCTATTGTGCATGTCTTGCTATTTTCTGAGCAGTAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078033 Essential Splice Site 119 494 3 11
Genomic Location:
Chromosome 12 (position 15196268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCACAGCGCATTCTAAAAGCTTGTGGTGGAGGAAGCCTTGGTACTGG[A/T]AAATGTTTTAATTAGATTTACATTACTAAGTAAACATGTATTTAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078033 Essential Splice Site 376 494 9 11
Genomic Location:
Chromosome 12 (position 15234801)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTATATAAAGAGTTTAGTAATTTAAAATTTGTAACTTTTTTTTTTTTA[G/T]GAACGCTCAGACACTTTGGCTGCTCTAGCAGAGAAAGCCAGCATGACGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link