ankrd33aa

Ensembl ID:
ENSDARG00000055638
ZFIN ID:
ZDB-GENE-080520-2
Human Orthologue:
ANKRD33
Human Description:
ankyrin repeat domain 33 [Source:HGNC Symbol;Acc:13788]
Mouse Orthologue:
Ankrd33
Mouse Description:
ankyrin repeat domain 33 Gene [Source:MGI Symbol;Acc:MGI:2443398]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4222 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19328 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12836 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078030 Essential Splice Site 137 452 3 4
ENSDART00000143662 Essential Splice Site 137 428 4 5
ENSDART00000078030 Essential Splice Site 137 452 3 4
ENSDART00000143662 Essential Splice Site 137 428 4 5
Genomic Location:
Chromosome 23 (position 28109077)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAAACACGAAAGATTCTTAATACTTAATTCTAAGTTTAAATGTTGC[A/C]GGTTTCGTAACCATCCTCACTTACATCATCAATTTCTTCCCTGGACTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078030 Essential Splice Site 137 452 3 4
ENSDART00000143662 Essential Splice Site 137 428 4 5
ENSDART00000078030 Essential Splice Site 137 452 3 4
ENSDART00000143662 Essential Splice Site 137 428 4 5
Genomic Location:
Chromosome 23 (position 28109077)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAAAACACGAAAGATTCTTAATACTTAATTCTAAGTTTAAATGTTGC[A/C]GGTTTCGTAACCATCCTCACTTACATCATCAATTTCTTCCCTGGACTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078030 Nonsense 441 452 4 4
ENSDART00000143662 None None 428 None 5
Genomic Location:
Chromosome 23 (position 28103408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGCCAAAGAGGAGAAAAAAAAAGAGAAGAAAAAAGAAGAACAGGAG[A/T]AGCTGGAAAAAGGAGCCAAGAAAAAAAGTAAAAAGTGATTCAACTGCCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Working memory: Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1aaijkxx