foxh1

Ensembl ID:
ENSDARG00000055630
ZFIN ID:
ZDB-GENE-000616-15
Description:
Forkhead box protein H1 [Source:UniProtKB/Swiss-Prot;Acc:Q9I9E1]
Human Orthologue:
FOXH1
Human Description:
forkhead box H1 [Source:HGNC Symbol;Acc:3814]
Mouse Orthologue:
Foxh1
Mouse Description:
forkhead box H1 Gene [Source:MGI Symbol;Acc:MGI:1347465]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6241 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa6241
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078021 Nonsense 163 472 3 3
Genomic Location:
Chromosome 12 (position 14833028)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTAACATTATCTTGTTGCCCTTAACTATCTAGGTGCTTAAAGATCCT[G/T]GAAAACCTCAAGGTAAAGGTAACTTTTGGACTGTGGAAGTGAACCGAATT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Quality Tag
Larval:Day 4
ZFS:0000036
head
ZFA:0001114
quality
PATO:0000001
normal
PATO:0000461
Larval:Day 4
ZFS:0000036
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
trunk
ZFA:0001115
bent
PATO:0000617
abnormal
PATO:0000460

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jv23lzth