c3orf58b

Ensembl ID:
ENSDARG00000055629
ZFIN ID:
ZDB-GENE-070830-2
Description:
hypothetical protein LOC100141362 [Source:RefSeq peptide;Acc:NP_001108398]
Human Orthologue:
C3orf58
Human Description:
chromosome 3 open reading frame 58 [Source:HGNC Symbol;Acc:28490]
Mouse Orthologue:
1190002N15Rik
Mouse Description:
RIKEN cDNA 1190002N15 gene Gene [Source:MGI Symbol;Acc:MGI:1916111]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37813 Nonsense Mutation detected in F1 DNA During 2016
sa4285 Nonsense Mutation detected in F1 DNA During 2016
sa11745 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078019 Nonsense 249 429 2 3
ENSDART00000137293 Nonsense 249 429 3 4
Genomic Location:
Chromosome 24 (position 5750584)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTGCCTGCGGCCGAATGGTGGCGGTGAACTACGTAGGCGAGGAGCTGT[G/A]GAGTTTCTTCAACGCTCCTTGGGAAAAGAGAGTCGATCTGGCCAAGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078019 Nonsense 316 429 2 3
ENSDART00000137293 Nonsense 316 429 3 4
Genomic Location:
Chromosome 24 (position 5750383)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAARGTCATCGTGGTGGAYGCGGAGAATGTSGTGGTGGCYGACAAGAGGT[T/A]GATCAAGCAGAGTAAGTMAAGAGATGKACTGTAAATTTCAGGATGCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078019 Nonsense 369 429 3 3
ENSDART00000137293 Nonsense 369 429 4 4
Genomic Location:
Chromosome 24 (position 5736940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTCACAGTGGACCACAACTATTACGCCATCTGTCAGAATCTGCTTTCG[C/T]GATATGCTACATGGCGGGGGAGCTCCGGCGGRCTCCTTCACGACCCCCCR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link