c3orf58b

Ensembl ID:
ENSDARG00000055629
ZFIN ID:
ZDB-GENE-070830-2
Description:
hypothetical protein LOC100141362 [Source:RefSeq peptide;Acc:NP_001108398]
Human Orthologue:
C3orf58
Human Description:
chromosome 3 open reading frame 58 [Source:HGNC Symbol;Acc:28490]
Mouse Orthologue:
1190002N15Rik
Mouse Description:
RIKEN cDNA 1190002N15 gene Gene [Source:MGI Symbol;Acc:MGI:1916111]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4285 Nonsense Mutation detected in F1 DNA During 2014
sa11745 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078019 Nonsense 316 429 2 3
ENSDART00000137293 Nonsense 316 429 3 4
Genomic Location:
Chromosome 24 (position 5750383)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAARGTCATCGTGGTGGAYGCGGAGAATGTSGTGGTGGCYGACAAGAGGT[T/A]GATCAAGCAGAGTAAGTMAAGAGATGKACTGTAAATTTCAGGATGCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078019 Nonsense 369 429 3 3
ENSDART00000137293 Nonsense 369 429 4 4
Genomic Location:
Chromosome 24 (position 5736940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTCACAGTGGACCACAACTATTACGCCATCTGTCAGAATCTGCTTTCG[C/T]GATATGCTACATGGCGGGGGAGCTCCGGCGGRCTCCTTCACGACCCCCCR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3oy5auon