acta1b

Ensembl ID:
ENSDARG00000055618
ZFIN ID:
ZDB-GENE-030131-55
Description:
actin, alpha skeletal muscle [Source:RefSeq peptide;Acc:NP_999949]
Human Orthologue:
ACTC1
Human Description:
actin, alpha, cardiac muscle 1 [Source:HGNC Symbol;Acc:143]
Mouse Orthologue:
Actc1
Mouse Description:
actin, alpha, cardiac muscle 1 Gene [Source:MGI Symbol;Acc:MGI:87905]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10892 Nonsense Available for shipment Available now
sa35480 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10892
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058629 Nonsense 296 377 6 7
Genomic Location (Zv9):
Chromosome 13 (position 24506273)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24151933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTACAACAGCATCATGAAGTGCGACATTGACATCAGGAAGGATCTGTA[T/A]GCCAACAATGTCTTGTCTGGTGGTACCACCATGTACCCAGGTATTGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058629 Nonsense 356 377 7 7
Genomic Location (Zv9):
Chromosome 13 (position 24507951)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24153611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCGTATGGATCGGTGGCTCCATCTTGGCTTCCCTGTCCACCTTCCAG[C/T]AGATGTGGATCACCAAGCAGGAATACGATGAGGCAGGTCCCAGCATTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link