exoc2

Ensembl ID:
ENSDARG00000055610
ZFIN ID:
ZDB-GENE-040426-1160
Description:
exocyst complex component 2 [Source:RefSeq peptide;Acc:NP_956898]
Human Orthologue:
EXOC2
Human Description:
exocyst complex component 2 [Source:HGNC Symbol;Acc:24968]
Mouse Orthologue:
Exoc2
Mouse Description:
exocyst complex component 2 Gene [Source:MGI Symbol;Acc:MGI:1913732]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37041 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077962 Nonsense 880 918 27 28
ENSDART00000134337   None 266 None 10

The following transcripts of ENSDARG00000055610 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 26603071)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26674374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTTGTGTCTCAGCACTAGTTTTAAGCAGGCATTGGAAGCGCTTCCA[C/T]AGCTACAGAGTGGAGCTGACAAAAAGTAAGTTACACTTCAGTATAGTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link