dnaja3b

Ensembl ID:
ENSDARG00000055606
ZFIN ID:
ZDB-GENE-040115-3
Description:
hypothetical protein LOC554962 [Source:RefSeq peptide;Acc:NP_001116708]
Human Orthologue:
DNAJA3
Human Description:
DnaJ (Hsp40) homolog, subfamily A, member 3 [Source:HGNC Symbol;Acc:11808]
Mouse Orthologue:
Dnaja3
Mouse Description:
DnaJ (Hsp40) homolog, subfamily A, member 3 Gene [Source:MGI Symbol;Acc:MGI:1933786]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16206 Essential Splice Site Available for shipment Available now
sa16207 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105122 Essential Splice Site 136 474 3 11
ENSDART00000122921   None 474 None 11
ENSDART00000139303 Essential Splice Site 136 326 3 7
Genomic Location (Zv9):
Chromosome 22 (position 26484714)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25914799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACCCTGATGCGAAAGAGAAGTTTGCCAAACTGGCAGAAGCTTATGAG[G/A]TGAGGAACATTTAATGCTTTTAATTGCTTTTAAATAAATAAAATTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105122   None 474 None 11
ENSDART00000122921 Essential Splice Site 136 474 3 11
ENSDART00000139303   None 326 None 7
Genomic Location (Zv9):
Chromosome 22 (position 26615498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACCCTGATGCAAAGGAGAAGTTTGCCAAACTGGCAGAAGCTTATGAG[G/A]TGAGGAACATTTAATGCTCATTTTCCTTCTATATATTTTTTATTATTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link