clul1

Ensembl ID:
ENSDARG00000055595
ZFIN ID:
ZDB-GENE-031118-57
Description:
clusterin-like protein 1 [Source:RefSeq peptide;Acc:NP_001093464]
Human Orthologue:
CLUL1
Human Description:
clusterin-like 1 (retinal) [Source:HGNC Symbol;Acc:2096]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19790 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098988 Essential Splice Site 87 466 3 9
ENSDART00000125746 Essential Splice Site 87 222 3 5
Genomic Location:
Chromosome 2 (position 31088919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGCAAACCTAATGAAGTCCCTGAGGCACAGCGAGGAGAAGAAAAAG[G/A]TCAGGAAATTTGTCAGTTGGGTTGAACATGCAAGAATACACACATAGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xw4emtf1