capn2b

Ensembl ID:
ENSDARG00000055592
ZFIN ID:
ZDB-GENE-050522-84
Description:
calpain 2, (m/II) large subunit b [Source:RefSeq peptide;Acc:NP_001018177]
Human Orthologue:
CAPN2
Human Description:
calpain 2, (m/II) large subunit [Source:HGNC Symbol;Acc:1479]
Mouse Orthologue:
Capn2
Mouse Description:
calpain 2 Gene [Source:MGI Symbol;Acc:MGI:88264]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24190 Nonsense Available for shipment Available now
sa9474 Nonsense Available for shipment Available now
sa19299 Nonsense Mutation detected in F1 DNA During 2016
sa37530 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077958 Nonsense 290 696 7 21
ENSDART00000105101 Nonsense 290 695 7 20
ENSDART00000130493 Nonsense 7 413 8 22
Genomic Location (Zv9):
Chromosome 22 (position 26932867)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26321647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTATCGTGGTCGCAAGGAAAAGCTGGTTCGTATGCGCAACCCTTGGGGA[C/T]AGGTGGAGTGGACCGGAGCCTGGAGCGACAAGTAAGGTTTCATTACTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077958 Nonsense 395 696 10 21
ENSDART00000105101 Nonsense 395 695 10 20
ENSDART00000130493 Nonsense 112 413 11 22
ENSDART00000077958 Nonsense 395 696 10 21
ENSDART00000105101 Nonsense 395 695 10 20
ENSDART00000130493 Nonsense 112 413 11 22
Genomic Location (Zv9):
Chromosome 22 (position 26928440)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26317314
KASP Assay ID:
2261-6935.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTTGGATGAATCCACAATTTGTGGTGAAACTGGATGAAGAAAATGTY[G/T]AAGATAAGGAGAAGGGCTGCAGTTTTGTAGTGGGTCTGATTCAGAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077958 Nonsense 395 696 10 21
ENSDART00000105101 Nonsense 395 695 10 20
ENSDART00000130493 Nonsense 112 413 11 22
ENSDART00000077958 Nonsense 395 696 10 21
ENSDART00000105101 Nonsense 395 695 10 20
ENSDART00000130493 Nonsense 112 413 11 22
Genomic Location (Zv9):
Chromosome 22 (position 26928440)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26317314
KASP Assay ID:
2261-6935.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTTGGATGAATCCACAATTTGTGGTGAAACTGGATGAAGAAAATGTC[G/T]AAGATAAGGAGAAGGGCTGCAGTTTTGTAGTGGGTCTGATTCAGAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077958 Nonsense 525 696 14 21
ENSDART00000105101 Nonsense 524 695 13 20
ENSDART00000130493 Nonsense 242 413 15 22
Genomic Location (Zv9):
Chromosome 22 (position 26924426)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26313300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCACATACTGTGCCTATTTTTGTTTTCAGGAGACTGTCTCAGATGAT[C/T]AAGTTGATTCAAAGTTTAGGGGGATGTTCGTAAAACTTGCCGGACCTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link