Q4V9N0_DANRE

Ensembl ID:
ENSDARG00000055591
Description:
LOC558601 protein [Source:UniProtKB/TrEMBL;Acc:Q4V9N0]
Human Orthologue:
PIPOX
Human Description:
pipecolic acid oxidase [Source:HGNC Symbol;Acc:17804]
Mouse Orthologue:
Pipox
Mouse Description:
pipecolic acid oxidase Gene [Source:MGI Symbol;Acc:MGI:1197006]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13980 Essential Splice Site Available for shipment Available now
sa22647 Essential Splice Site Available for shipment Available now
sa39043 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13980
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077980 Essential Splice Site 46 397 1 8
Genomic Location (Zv9):
Chromosome 15 (position 23532273)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24243460
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCTATCAGCTGGCCAARAACAAGCAGAAAACTCTGCTGCTGGAGCAG[G/A]TCGGTTACCGYCAGATTTTTTACTGTATTRAAAGCAAGACACGTGTAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077980 Essential Splice Site 168 397 4 8
Genomic Location (Zv9):
Chromosome 15 (position 23520962)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24232149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGGTGCTCTTATTAGGATGAGATGTTTTGAATGTGTGTGTGTTGTTC[A/C]GAGGCTGTTTCAGTGCAGTGGTGGAGTGCTGAAGGACGGGCAGACAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077980 Nonsense 261 397 5 8
Genomic Location (Zv9):
Chromosome 15 (position 23518381)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24229568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTACAGTGTCGACCAGAGCTTTCCATGCTTTATACAGATGGAGCCGAAA[G/T]AGGGGGAATATGACATTTATGGCCTTCCATCCAATGAATATCCAGGACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link