chrm2a

Ensembl ID:
ENSDARG00000055577
ZFIN ID:
ZDB-GENE-030314-1
Description:
muscarinic acetylcholine receptor M2 [Source:RefSeq peptide;Acc:NP_840086]
Human Orthologue:
CHRM2
Human Description:
cholinergic receptor, muscarinic 2 [Source:HGNC Symbol;Acc:1951]
Mouse Orthologue:
Chrm2
Mouse Description:
cholinergic receptor, muscarinic 2, cardiac Gene [Source:MGI Symbol;Acc:MGI:88397]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11876 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077955 Nonsense 80 384 2 2
Genomic Location:
Chromosome 4 (position 1203174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTTTGCTCCATGAACTTATACACAGTCTATATTGTAATCGGATATTG[G/A]CCACTAGGCCCGGTTGTGTGTGATTTGTGGTTGGCGCTGGATTATGTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vvqazalb