gpr61

Ensembl ID:
ENSDARG00000055570
ZFIN ID:
ZDB-GENE-081104-239
Description:
Novel protein similar to H.sapiens GPR61, G protein-coupled receptor 61 (GPR61) [Source:UniProtKB/Tr
Human Orthologue:
GPR61
Human Description:
G protein-coupled receptor 61 [Source:HGNC Symbol;Acc:13300]
Mouse Orthologue:
Gpr61
Mouse Description:
G protein-coupled receptor 61 Gene [Source:MGI Symbol;Acc:MGI:2441719]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12995 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077950 Nonsense 323 421 1 1
ENSDART00000142006 Nonsense 363 452 2 2
Genomic Location:
Chromosome 8 (position 26030441)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCAGATCAGGGAGGAGCTGGCCAGAAACTTGGCCTTCGTGTTCAAGTG[G/A]GGKCRTCCCGGTGAGGAGGATCAGCTGCCCAGTCGARAGGCKTCTATCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/96lnb0ip