LOC100149775

Ensembl ID:
ENSDARG00000055567
Human Orthologue:
KLHL33
Human Description:
kelch-like 33 (Drosophila) [Source:HGNC Symbol;Acc:31952]
Mouse Orthologue:
AC027184.1
Mouse Description:
kelch-like 33 [Source:RefSeq peptide;Acc:NP_001160123]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2391 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2391
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077940 Nonsense 535 1014 2 4
Genomic Location:
Chromosome 7 (position 4455212)
KASP Assay ID:
554-3443.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGGCTCTTGCTCTTGGATGGGGTTGTGTGTTTGATCTGGCCTGTACAT[C/A]GCTCCAATTACAGTTTCAGACTGCCTTCTCACTATGCACTAAATTTCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tj2rt1zz