cacnb2b

Ensembl ID:
ENSDARG00000055565
ZFIN ID:
ZDB-GENE-050208-129
Description:
calcium channel, voltage-dependent, beta 2b isoform 2 [Source:RefSeq peptide;Acc:NP_001159796]
Human Orthologues:
CACNB1, CACNB2, CACNB3, CACNB4
Human Descriptions:
calcium channel, voltage-dependent, beta 1 subunit [Source:HGNC Symbol;Acc:1401]
calcium channel, voltage-dependent, beta 2 subunit [Source:HGNC Symbol;Acc:1402]
calcium channel, voltage-dependent, beta 3 subunit [Source:HGNC Symbol;Acc:1403]
calcium channel, voltage-dependent, beta 4 subunit [Source:HGNC Symbol;Acc:1404]
Mouse Orthologues:
Cacnb1, Cacnb2, Cacnb3, Cacnb4
Mouse Descriptions:
calcium channel, voltage-dependent, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:102522]
calcium channel, voltage-dependent, beta 2 subunit Gene [Source:MGI Symbol;Acc:MGI:894644]
calcium channel, voltage-dependent, beta 3 subunit Gene [Source:MGI Symbol;Acc:MGI:103307]
calcium channel, voltage-dependent, beta 4 subunit Gene [Source:MGI Symbol;Acc:MGI:103301]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10313 Essential Splice Site Available for shipment Available now
sa16129 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049219 Essential Splice Site 282 374 10 14
ENSDART00000123495 Essential Splice Site 282 600 10 13
ENSDART00000126594 Essential Splice Site 285 377 11 14
ENSDART00000130722 Essential Splice Site 285 377 11 15

The following transcripts of ENSDARG00000055565 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 31219352)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCTCCTTGGCCCCGATCCTGGTGTATGTCAAGATTTCATCCCCCAAG[G/A]TCAGAAACATTGTYCACAGAACTCACAGACATAACCATCATTTATTACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049219 Essential Splice Site 282 374 None 14
ENSDART00000123495 Essential Splice Site 282 600 None 13
ENSDART00000126594 Essential Splice Site 285 377 None 14
ENSDART00000130722 Essential Splice Site 285 377 None 15

The following transcripts of ENSDARG00000055565 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 31219353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCTCCTTGGCCCCGATCCTGGTGTATGTCAAGATTTCATCCCCCAAGR[T/G]CAGAAACATTGTTCACAGAACTCACAGACATAACCATCATTTATTACGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xlplrnfe