rnasen

Ensembl ID:
ENSDARG00000055563
ZFIN ID:
ZDB-GENE-070209-23
Description:
ribonuclease 3 [Source:RefSeq peptide;Acc:NP_001103942]
Human Orthologue:
DROSHA
Human Description:
drosha, ribonuclease type III [Source:HGNC Symbol;Acc:17904]
Mouse Orthologue:
Rnasen
Mouse Description:
ribonuclease III, nuclear Gene [Source:MGI Symbol;Acc:MGI:1261425]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa191 Nonsense Available for shipment Available now
sa13985 Nonsense Available for shipment Available now
sa31863 Nonsense Available for shipment Available now
sa35230 Essential Splice Site Available for shipment Available now
sa17917 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089017 Nonsense 142 1289 2 31

The following transcripts of ENSDARG00000055563 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 14455396)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13311049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCACCCACTATGCCCTACCCTCCAACATACCCTATGAGCTACCCTCCA[C/T]AACCCCAGCTTCCCCCTCCACCCAGCTTCAACCCAGCTTATGGTCAGCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089017 Nonsense 698 1289 13 31

The following transcripts of ENSDARG00000055563 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 14467625)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13323278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCAACTCCAGTGTCATTACTTTCCCMATAATTGTGCAWTTTGGTATM[C/T]GACCTGCTCAGCTTAGCTACGCTGGAGACCCGCAGTAAGTGTGACCGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31863
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089017 Nonsense 792 1289 16 31

The following transcripts of ENSDARG00000055563 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 14472788)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13328441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTGCAGCACGCTATGATGCTTCCTGTTCTCACCCATCACATCCGCTA[T/A]CACCAGTGCCTGATGCATTTGGATAAGCTGATTGGTTACATGTTTAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089017 Essential Splice Site 861 1289 17 31

The following transcripts of ENSDARG00000055563 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 14473698)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13329351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAATATGGAGACCGGAAAGTGCATCATATGTACATGAGGAAAAAAGG[T/C]TAGCAAATATTCTTGTAAATGTATGTTAGAAAATGTTTTTAATGTAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089017 Nonsense 1279 1289 31 31

The following transcripts of ENSDARG00000055563 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 14495599)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13351252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCATCGAAAGAAAGTACCGTCAAGAACTGAAGGAGATGAGAAGAGAG[C/T]GAGAGAGACAGGAGAGAGATAGTGATKAAGGATAGAACAGCAGAAAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link