rnasen

Ensembl ID:
ENSDARG00000055563
ZFIN ID:
ZDB-GENE-070209-23
Description:
ribonuclease 3 [Source:RefSeq peptide;Acc:NP_001103942]
Human Orthologue:
DROSHA
Human Description:
drosha, ribonuclease type III [Source:HGNC Symbol;Acc:17904]
Mouse Orthologue:
Rnasen
Mouse Description:
ribonuclease III, nuclear Gene [Source:MGI Symbol;Acc:MGI:1261425]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa191 Nonsense Available for shipment Available now
sa13985 Nonsense Available for shipment Available now
sa17917 Nonsense Available for shipment Available now
sa7692 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089017 Nonsense 142 1289 2 31

The following transcripts of ENSDARG00000055563 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 14455396)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCACCCACTATGCCCTACCCTCCAACATACCCTATGAGCTACCCTCCA[C/T]AACCCCAGCTTCCCCCTCCACCCAGCTTCAACCCAGCTTATGGTCAGCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089017 Nonsense 698 1289 13 31

The following transcripts of ENSDARG00000055563 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 14467625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCAACTCCAGTGTCATTACTTTCCCMATAATTGTGCAWTTTGGTATM[C/T]GACCTGCTCAGCTTAGCTACGCTGGAGACCCGCAGTAAGTGTGACCGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089017 Nonsense 1279 1289 31 31

The following transcripts of ENSDARG00000055563 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 14495599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCATCGAAAGAAAGTACCGTCAAGAACTGAAGGAGATGAGAAGAGAG[C/T]GAGAGAGACAGGAGAGAGATAGTGATKAAGGATAGAACAGCAGAAAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089017 Nonsense 1288 1289 31 31

The following transcripts of ENSDARG00000055563 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 14495626)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGAAGGAGATGAGAAGAGAGCGAGAGAGACAGGAGAGAGATAGTGAT[G/T]AAGGATAGAACAGCAGAAAGTGGAGAAGGAAAAGCATTTCTTAGGTAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8fxw0oae