chrna6

Ensembl ID:
ENSDARG00000055559
ZFIN ID:
ZDB-GENE-090312-91
Description:
neuronal acetylcholine receptor subunit alpha-6 [Source:RefSeq peptide;Acc:NP_001036149]
Human Orthologue:
CHRNA6
Human Description:
cholinergic receptor, nicotinic, alpha 6 [Source:HGNC Symbol;Acc:15963]
Mouse Orthologue:
Chrna6
Mouse Description:
cholinergic receptor, nicotinic, alpha polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:106213]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15480 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031546 Essential Splice Site 118 512 4 6
Genomic Location:
Chromosome 1 (position 21265484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTCCCATCCAATAAAATCTGGAGGCCTGACRTTGTACTTTACAACAA[G/A]TGAGTCTTTCAACCTAACACTAAAGCTGTATACATATGTATGAATTMATR
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ivqh7qhu