Q503E7_DANRE

Ensembl ID:
ENSDARG00000055548
Description:
Npat protein [Source:UniProtKB/TrEMBL;Acc:Q503E7]
Human Orthologue:
NPAT
Human Description:
nuclear protein, ataxia-telangiectasia locus [Source:HGNC Symbol;Acc:7896]
Mouse Orthologue:
Npat
Mouse Description:
nuclear protein in the AT region Gene [Source:MGI Symbol;Acc:MGI:107605]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16436 Nonsense Available for shipment Available now
sa10511 Essential Splice Site Available for shipment Available now
sa17688 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077919   None 413 None 14
ENSDART00000123143 Nonsense 473 1328 14 21
Genomic Location (Zv9):
Chromosome 15 (position 24864731)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25598163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCTTCCTCTACAGCTCCACAGGCACATCACCTAACCAAACAAACTGGA[C/T]GAGGATCCACAAACTCCAAAAGAGGGCTGATCAGGGCTAGAGTTTCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077919   None 413 None 14
ENSDART00000123143 Essential Splice Site 852 1328 15 21
Genomic Location (Zv9):
Chromosome 15 (position 24867805)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25601225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RCATTCTTTTTCTCTTCCTGCATGTTTGAAATTCCAACTTTTTTATTTTT[A/T]GGCTCMACTATTATTATATCGTCACCTGTTCAGCCTATGTTACAAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077919   None 413 None 14
ENSDART00000123143 Nonsense 1071 1328 20 21
Genomic Location (Zv9):
Chromosome 15 (position 24869471)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 25602886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACATCATCTGTCCCGGGGCCAAAACAGAAACCATCAGACAACTCGAAA[G/T]AATCATCAGGTGAAAAGACTCTCTCARAYCCACCAGAAATGTCCTCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link