appb

Ensembl ID:
ENSDARG00000055543
ZFIN ID:
ZDB-GENE-020220-1
Description:
amyloid beta (A4) precursor protein b [Source:RefSeq peptide;Acc:NP_690842]
Human Orthologue:
APP
Human Description:
amyloid beta (A4) precursor protein [Source:HGNC Symbol;Acc:620]
Mouse Orthologue:
App
Mouse Description:
amyloid beta (A4) precursor protein Gene [Source:MGI Symbol;Acc:MGI:88059]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa327 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa327
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077894 None None 362 None 11
ENSDART00000077901 Nonsense 142 694 4 17
ENSDART00000077908 Nonsense 142 751 4 17
ENSDART00000100684 Nonsense 142 660 4 17
ENSDART00000122679 None None 362 None 12
ENSDART00000122787 None None 83 None 3
ENSDART00000125536 Nonsense 142 694 4 16
Genomic Location:
Chromosome 9 (position 36026372)
KASP Assay ID:
554-3359.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCGATGCCCTCCTCGTCCCAGATAAGTGCAAGTTCTTGCACCAGGAG[C/T]GAATGGACATGTGCGAGAGTCATCTACACTGGCATACAGTGGCCAAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ynk82an3