appb

Ensembl ID:
ENSDARG00000055543
ZFIN ID:
ZDB-GENE-020220-1
Description:
amyloid beta (A4) precursor protein b [Source:RefSeq peptide;Acc:NP_690842]
Human Orthologue:
APP
Human Description:
amyloid beta (A4) precursor protein [Source:HGNC Symbol;Acc:620]
Mouse Orthologue:
App
Mouse Description:
amyloid beta (A4) precursor protein Gene [Source:MGI Symbol;Acc:MGI:88059]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa327 Nonsense F2 line generated During 2016
sa34693 Nonsense Mutation detected in F1 DNA During 2016
sa41475 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa327
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077894   None 362 None 11
ENSDART00000077901 Nonsense 142 694 4 17
ENSDART00000077908 Nonsense 142 751 4 17
ENSDART00000100684 Nonsense 142 660 4 17
ENSDART00000122679   None 362 None 12
ENSDART00000122787   None 83 None 3
ENSDART00000125536 Nonsense 142 694 4 16
Genomic Location:
Chromosome 9 (position 36026372)
KASP Assay ID:
554-3359.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCGATGCCCTCCTCGTCCCAGATAAGTGCAAGTTCTTGCACCAGGAG[C/T]GAATGGACATGTGCGAGAGTCATCTACACTGGCATACAGTGGCCAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077894 Nonsense 102 362 4 11
ENSDART00000077901 Nonsense 434 694 10 17
ENSDART00000077908 Nonsense 491 751 11 17
ENSDART00000100684 Nonsense 434 660 10 17
ENSDART00000122679 Nonsense 102 362 5 12
ENSDART00000122787   None 83 None 3
ENSDART00000125536 Nonsense 434 694 10 16
Genomic Location:
Chromosome 9 (position 36004688)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTAAAAATAATCCTGTCTCATACAGCCTCGGCAGGTGCTGAATCTGT[T/A]GAAGAAGTATATCCGTGCGGAGCAGAAGGACCGTCAGCACACTCTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077894 Nonsense 121 362 4 11
ENSDART00000077901 Nonsense 453 694 10 17
ENSDART00000077908 Nonsense 510 751 11 17
ENSDART00000100684 Nonsense 453 660 10 17
ENSDART00000122679 Nonsense 121 362 5 12
ENSDART00000122787   None 83 None 3
ENSDART00000125536 Nonsense 453 694 10 16
Genomic Location:
Chromosome 9 (position 36004632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATATCCGTGCGGAGCAGAAGGACCGTCAGCACACTCTCAAACACTTT[G/T]AACACGTGCGGGAGGTCGATCCCAAGAAGGCTTCACAGATTCGGCCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link