pfkfb4

Ensembl ID:
ENSDARG00000055540
ZFIN ID:
ZDB-GENE-051120-51
Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 [Source:RefSeq peptide;Acc:NP_001032454]
Human Orthologue:
PFKFB4
Human Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 [Source:HGNC Symbol;Acc:8875]
Mouse Orthologue:
Pfkfb4
Mouse Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 Gene [Source:MGI Symbol;Acc:MGI:2687284]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27816 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35129 Essential Splice Site Mutation detected in F1 DNA During 2017
sa27815 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077883 Essential Splice Site 46 482 1 14
ENSDART00000133302   None 453 None 14
Genomic Location (Zv9):
Chromosome 11 (position 35409549)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34309923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCCTCCAGAAACGGCCTTCCTGACAGGCACATTAGTCAGAAAAAGGG[T/G]AAGCATGAATGAAAGGATGAGATGCTGGAGGCAGATTTGGGTTAAAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077883 Essential Splice Site 85 482 2 14
ENSDART00000133302 Essential Splice Site 56 453 2 14
Genomic Location (Zv9):
Chromosome 11 (position 35407055)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34307429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAAAAAACTGACACGCTACCTCAACTGGATTGATGTTCCTACGAAAGG[T/C]TTGGATTGAGTTTACAAAGAGCAGATTTGTGAAATGCCAGGCCAAGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077883 Essential Splice Site 184 482 7 14
ENSDART00000133302 Essential Splice Site 155 453 7 14
Genomic Location (Zv9):
Chromosome 11 (position 35403745)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34304119
KASP Assay ID:
554-6693.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATATCTTTATCTCACTGTATTTTGTATAAATTTGTGCTTTTTGTGTGC[A/G]GCAAGTGAAGCTGGGCAGTCCAGACTACACACACTGTAACACAGAAGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link