otub1l

Ensembl ID:
ENSDARG00000055536
ZFIN ID:
ZDB-GENE-040718-108
Description:
OTU domain, ubiquitin aldehyde binding 1, like [Source:RefSeq peptide;Acc:NP_001002411]
Human Orthologue:
OTUB1
Human Description:
OTU domain, ubiquitin aldehyde binding 1 [Source:HGNC Symbol;Acc:23077]
Mouse Orthologue:
Otub1
Mouse Description:
OTU domain, ubiquitin aldehyde binding 1 Gene [Source:MGI Symbol;Acc:MGI:2147616]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5960 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077897 Nonsense 166 267 6 7
ENSDART00000140229 Nonsense 165 217 6 6

The following transcripts of ENSDARG00000055536 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27904697)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28473608
KASP Assay ID:
554-3732.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTAGGTGAGCTGCTCACCTCCTTCAATGAGCAGAGCGTGTCAGATTA[T/G]CTGGTCGTCTACCTGCGGCTGGTGACCTCCGGGTACCTRCAGAGAGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link