cmn

Ensembl ID:
ENSDARG00000055527
ZFIN ID:
ZDB-GENE-000208-9
Description:
calymmin [Source:RefSeq peptide;Acc:NP_571089]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22049 Essential Splice Site Available for shipment Available now
sa22050 Nonsense Available for shipment Available now
sa12588 Nonsense Available for shipment Available now
sa22051 Essential Splice Site Available for shipment Available now
sa3334 Essential Splice Site F2 line generated During 2016
sa41981 Nonsense Mutation detected in F1 DNA During 2016
sa2627 Essential Splice Site F2 line generated During 2016
sa35227 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22049
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 348 1207 21 54
ENSDART00000124453 Essential Splice Site 348 1249 21 56
ENSDART00000127870   None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14239177)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13094830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATAGCTAACTGAAGCACCTCTAAATGGATTTGGGATTGTTTGTTGTTC[A/G]GGAAATGGAGGATATCCTAATGGAGGCGCAACTAGTCAACATAATGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22050
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Nonsense 437 1207 26 54
ENSDART00000124453 Nonsense 437 1249 26 56
ENSDART00000127870   None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14242095)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13097748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCATTTAAACTGATTTGGGATTTTTTTTGTTCAGGATATGGAGGATA[T/A]CCTAATGGAGGCGCAGCTAACCAGCCTAATGGGGGTAATATGAATGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Nonsense 572 1207 34 54
ENSDART00000124453 Nonsense 614 1249 36 56
ENSDART00000127870   None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14245389)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13101042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGTAAACTTTTAACTGTCATATTAACTTTCTTGTGACCTACAGGTTA[C/A]GGTGTTCCTGGATATAYGTCAAAAGGACCTAAAGCAGCWAATTCAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22051
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 790 1207 35 54
ENSDART00000124453 Essential Splice Site 832 1249 37 56
ENSDART00000127870   None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14246189)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13101842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAACCCTGCTTTGCCTCAGTTGAAGAATCCAACCACAACAAATCCTGG[T/C]AAATCTCTAAAGTTTCAGATTAAAATGTTACATGATCTCCTCTAACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3334
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 875 1207 41 54
ENSDART00000124453 Essential Splice Site 917 1249 43 56
ENSDART00000127870   None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14248811)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13104464
KASP Assay ID:
554-2450.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACCAGGTTTTCTTTRAGACAACTAAATGTCTTTTCTGTTACTTTGAT[A/G]GCTGGACTACAAGGTGGACCACCAGCACGATTGGGAACAAAGGGAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Nonsense 886 1207 41 54
ENSDART00000124453 Nonsense 928 1249 43 56
ENSDART00000127870   None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14248845)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13104498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGTTACTTTGATAGCTGGACTACAAGGTGGACCACCAGCACGATTG[G/T]GAACAAAGGGAAAATCTCAAACAAAATATGGTTAGTCTTAGGAGGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2627
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 896 1207 41 54
ENSDART00000124453 Essential Splice Site 938 1249 43 56
ENSDART00000127870   None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14248877)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13104530
KASP Assay ID:
554-2508.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCACCAGCACGATTGGGAACAAAGGGAAAATCTCAAACAAAATATGG[T/C]TAGTCTTAGGAGGAAAATKTAAAAATTTTAAAACTAATTATGTTGTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Nonsense 990 1207 46 54
ENSDART00000124453 Nonsense 1032 1249 48 56
ENSDART00000127870   None 136 None 8
Genomic Location (Zv9):
Chromosome 12 (position 14251316)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13106969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTTTACTGTCATTTTTTTCAGGACAAAAGGGTCCTCAATATGGTGGT[C/T]AGTCCCTTGGTCACGGGCCTGATGCAATTTCTGGAAAATACGGTGACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link