cmn

Ensembl ID:
ENSDARG00000055527
ZFIN ID:
ZDB-GENE-000208-9
Description:
calymmin [Source:RefSeq peptide;Acc:NP_571089]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22049 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22050 Nonsense Available for shipment Available now
sa7690 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa5597 Essential Splice Site Mutation detected in F1 DNA Unknown
sa12588 Nonsense Available for shipment Available now
sa22051 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3334 Essential Splice Site F2 line generated During 2014
sa2627 Essential Splice Site F2 line generated During 2014
sa4456 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 348 1207 21 54
ENSDART00000124453 Essential Splice Site 348 1249 21 56
ENSDART00000127870 None None 136 None 8
Genomic Location:
Chromosome 12 (position 14239177)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATAGCTAACTGAAGCACCTCTAAATGGATTTGGGATTGTTTGTTGTTC[A/G]GGAAATGGAGGATATCCTAATGGAGGCGCAACTAGTCAACATAATGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22050
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Nonsense 437 1207 26 54
ENSDART00000124453 Nonsense 437 1249 26 56
ENSDART00000127870 None None 136 None 8
Genomic Location:
Chromosome 12 (position 14242095)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCATTTAAACTGATTTGGGATTTTTTTTGTTCAGGATATGGAGGATA[T/A]CCTAATGGAGGCGCAGCTAACCAGCCTAATGGGGGTAATATGAATGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Splice Site, Nonsense 484 1207 28 54
ENSDART00000124453 Splice Site, Nonsense 484 1249 28 56
ENSDART00000127870 None None 136 None 8
Genomic Location:
Chromosome 12 (position 14242443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATGGTGCTAATGCTGGACCTTCAGCTGGACAAGTAGCCAAGCCTAAT[G/T]GTAAACTGTATTAAATTAGTTAACTATTMATTGTTACAGTTCTAAACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 517 1207 30 54
ENSDART00000124453 Essential Splice Site 517 1249 30 56
ENSDART00000127870 None None 136 None 8
Genomic Location:
Chromosome 12 (position 14242733)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCAATATATGGGTTATCCCAATGGTGGAGCCAAGGGACCTAAAGCAG[G/A]TAAACCTTTTAATGTGCAGTGGGTATGGTGGTTATTTTTAATCAATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Nonsense 572 1207 34 54
ENSDART00000124453 Nonsense 614 1249 36 56
ENSDART00000127870 None None 136 None 8
Genomic Location:
Chromosome 12 (position 14245389)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGTAAACTTTTAACTGTCATATTAACTTTCTTGTGACCTACAGGTTA[C/A]GGTGTTCCTGGATATAYGTCAAAAGGACCTAAAGCAGCWAATTCAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 790 1207 35 54
ENSDART00000124453 Essential Splice Site 832 1249 37 56
ENSDART00000127870 None None 136 None 8
Genomic Location:
Chromosome 12 (position 14246189)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAACCCTGCTTTGCCTCAGTTGAAGAATCCAACCACAACAAATCCTGG[T/C]AAATCTCTAAAGTTTCAGATTAAAATGTTACATGATCTCCTCTAACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3334
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 875 1207 41 54
ENSDART00000124453 Essential Splice Site 917 1249 43 56
ENSDART00000127870 None None 136 None 8
Genomic Location:
Chromosome 12 (position 14248811)
KASP Assay ID:
554-2450.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACCAGGTTTTCTTTRAGACAACTAAATGTCTTTTCTGTTACTTTGAT[A/G]GCTGGACTACAAGGTGGACCACCAGCACGATTGGGAACAAAGGGAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2627
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Essential Splice Site 896 1207 41 54
ENSDART00000124453 Essential Splice Site 938 1249 43 56
ENSDART00000127870 None None 136 None 8
Genomic Location:
Chromosome 12 (position 14248877)
KASP Assay ID:
554-2508.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCACCAGCACGATTGGGAACAAAGGGAAAATCTCAAACAAAATATGG[T/C]TAGTCTTAGGAGGAAAATKTAAAAATTTTAAAACTAATTATGTTGTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077840 Nonsense 975 1207 45 54
ENSDART00000124453 Nonsense 1017 1249 47 56
ENSDART00000127870 None None 136 None 8
Genomic Location:
Chromosome 12 (position 14250449)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTGGAGGGTTTCCCTACAATGGCCAGCCACTTGGATATGGCAGTGGC[A/T]AATCCACTGGCAAATATGGTGAATGNNNNNNNNNNNTTTTTTTCTTTTAACTTTTAAAAAR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sezrneqx