si:ch211-101n13.9

Ensembl ID:
ENSDARG00000055525
ZFIN ID:
ZDB-GENE-030616-570
Description:
hypothetical protein LOC368889 [Source:RefSeq peptide;Acc:NP_001007175]
Human Orthologue:
AC008074.1
Human Description:
Galectin-related protein [Source:UniProtKB/Swiss-Prot;Acc:Q3ZCW2]
Mouse Orthologues:
1110067D22Rik, Gm5065
Mouse Descriptions:
predicted gene 5065 Gene [Source:MGI Symbol;Acc:MGI:3643170]
RIKEN cDNA 1110067D22 gene Gene [Source:MGI Symbol;Acc:MGI:1916114]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22291 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077896 Nonsense 75 180 4 5
ENSDART00000147907 Nonsense 40 145 1 2
Genomic Location (Zv9):
Chromosome 13 (position 24776262)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24421922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCATACAGTTCTGAATGTTGGTTTTCTGCACAGCTTTGACATCAGTT[T/A]AACCTGTGGCCACAATGAGGAGAAAGAGGATGAAAAGCTCGCTGATGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link